Incidental Mutation 'R1577:Noc2l'
ID171213
Institutional Source Beutler Lab
Gene Symbol Noc2l
Ensembl Gene ENSMUSG00000095567
Gene NameNOC2 like nucleolar associated transcriptional repressor
SynonymsNIR
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156236010-156247616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156240622 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 151 (T151M)
Ref Sequence ENSEMBL: ENSMUSP00000137183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886]
Predicted Effect probably damaging
Transcript: ENSMUST00000179543
AA Change: T308M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567
AA Change: T308M

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179886
AA Change: T151M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567
AA Change: T151M

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone modification by histone acetyltransferases (HAT) and histone deacetylases (HDAC) can control major aspects of transcriptional regulation. NOC2L represents a novel HDAC-independent inhibitor of histone acetyltransferase (INHAT) (Hublitz et al., 2005 [PubMed 16322561]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice lacking expression of this gene display embryonic lethality prior to the tooth bud stage. Mice with an immune cell deletion display impaired T and B cell differentiation with a cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Noc2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Noc2l UTSW 4 156240096 small insertion probably benign
FR4449:Noc2l UTSW 4 156240101 small insertion probably benign
FR4548:Noc2l UTSW 4 156240092 small insertion probably benign
FR4548:Noc2l UTSW 4 156240100 small insertion probably benign
FR4737:Noc2l UTSW 4 156240094 small insertion probably benign
FR4737:Noc2l UTSW 4 156240095 small insertion probably benign
FR4737:Noc2l UTSW 4 156241501 critical splice donor site probably benign
FR4976:Noc2l UTSW 4 156240092 small insertion probably benign
FR4976:Noc2l UTSW 4 156240098 small insertion probably benign
R1633:Noc2l UTSW 4 156245293 missense probably benign 0.20
R1858:Noc2l UTSW 4 156245270 missense probably damaging 1.00
R1862:Noc2l UTSW 4 156237708 missense probably benign 0.00
R2069:Noc2l UTSW 4 156241450 nonsense probably null
R2862:Noc2l UTSW 4 156237450 missense probably benign 0.30
R4092:Noc2l UTSW 4 156242576 missense probably damaging 1.00
R4369:Noc2l UTSW 4 156237396 missense possibly damaging 0.68
R4964:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R4966:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R5922:Noc2l UTSW 4 156241313 nonsense probably null
R7081:Noc2l UTSW 4 156247020 missense possibly damaging 0.80
R7171:Noc2l UTSW 4 156241722 missense probably benign 0.05
R7315:Noc2l UTSW 4 156241360 missense probably damaging 0.98
R7317:Noc2l UTSW 4 156239216 missense possibly damaging 0.93
R7581:Noc2l UTSW 4 156245449 missense probably benign 0.00
R7690:Noc2l UTSW 4 156237631 missense probably benign 0.01
R7693:Noc2l UTSW 4 156240307 missense probably damaging 1.00
R8527:Noc2l UTSW 4 156241730 missense probably benign 0.05
R8542:Noc2l UTSW 4 156241730 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGTGCCGAATGTTGCTCAAG -3'
(R):5'- TCTCGTACCCAGAGGAAAAGAGCC -3'

Sequencing Primer
(F):5'- CCGAATGTTGCTCAAGGTACG -3'
(R):5'- ACCATCACCCAATTTTCTTGGTAAG -3'
Posted On2014-04-13