Incidental Mutation 'R1577:Med13l'
ID171215
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Namemediator complex subunit 13-like
Synonyms9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location118560679-118765438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118721392 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 215 (G215S)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
Predicted Effect probably damaging
Transcript: ENSMUST00000100816
AA Change: G215S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: G215S

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201010
AA Change: G215S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: G215S

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201614
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8347:Med13l UTSW 5 118742597 missense probably benign
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
R8508:Med13l UTSW 5 118754321 missense probably benign 0.34
R8920:Med13l UTSW 5 118747478 nonsense probably null
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCACGTCATGCTCTGGGCATTAAG -3'
(R):5'- GCAGGGGCCATTGGAGTTAAAACAC -3'

Sequencing Primer
(F):5'- CATGCTCTGGGCATTAAGATCTG -3'
(R):5'- TTGGAGTTAAAACACAATTCCCC -3'
Posted On2014-04-13