Incidental Mutation 'R1577:Tpcn1'
ID171216
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1577 (G1)
Quality Score205
Status Not validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120544420 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 508 (W508G)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably damaging
Transcript: ENSMUST00000046426
AA Change: W508G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: W508G

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGACTAGGAAGAGCCAGCTCTG -3'
(R):5'- AACGTGATCCACCATGTATCAGCC -3'

Sequencing Primer
(F):5'- GGTGGCCCCAGAGACTTTAG -3'
(R):5'- ATGTATCAGCCTTGCTTCTAGC -3'
Posted On2014-04-13