Incidental Mutation 'R1577:Zfp180'
ID171221
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R1577 (G1)
Quality Score179
Status Not validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24105908 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 584 (C584F)
Ref Sequence ENSEMBL: ENSMUSP00000064611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect probably damaging
Transcript: ENSMUST00000068975
AA Change: C584F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101
AA Change: C584F

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206482
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
IGL03134:Zfp180 UTSW 7 24104745 missense possibly damaging 0.50
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1555:Zfp180 UTSW 7 24101574 intron probably benign
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4551:Zfp180 UTSW 7 24104573 missense possibly damaging 0.87
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5610:Zfp180 UTSW 7 24104890 missense probably benign 0.00
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7006:Zfp180 UTSW 7 24105112 nonsense probably null
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
R7487:Zfp180 UTSW 7 24106100 missense probably damaging 1.00
R7766:Zfp180 UTSW 7 24104659 missense probably benign 0.37
R7816:Zfp180 UTSW 7 24105145 missense probably damaging 1.00
R8086:Zfp180 UTSW 7 24106110 missense probably benign
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Z1177:Zfp180 UTSW 7 24105871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGGGAAGTCGTTCATCCAG -3'
(R):5'- GATCAGTCCAGGAGTCAACATCAGC -3'

Sequencing Primer
(F):5'- cgcatcagagaacccacac -3'
(R):5'- GTCCTCACTGTGAGTAGCCTG -3'
Posted On2014-04-13