Incidental Mutation 'R1577:Olfr520'
ID171224
Institutional Source Beutler Lab
Gene Symbol Olfr520
Ensembl Gene ENSMUSG00000073998
Gene Nameolfactory receptor 520
SynonymsMOR101-1, GA_x6K02T2PBJ9-2411789-2412739
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R1577 (G1)
Quality Score223
Status Not validated
Chromosome7
Chromosomal Location99730273-99736399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99735356 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 71 (L71P)
Ref Sequence ENSEMBL: ENSMUSP00000151459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098264] [ENSMUST00000220185]
Predicted Effect probably damaging
Transcript: ENSMUST00000098264
AA Change: L71P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095864
Gene: ENSMUSG00000073998
AA Change: L71P

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.2e-59 PFAM
Pfam:7tm_1 46 295 7.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207139
Predicted Effect probably damaging
Transcript: ENSMUST00000220185
AA Change: L71P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Olfr520
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr520 APN 7 99735317 missense probably benign 0.00
IGL01745:Olfr520 APN 7 99735388 missense probably damaging 0.96
IGL01932:Olfr520 APN 7 99735500 missense probably damaging 0.99
IGL01987:Olfr520 APN 7 99735271 missense probably damaging 0.98
R0014:Olfr520 UTSW 7 99736049 missense probably damaging 0.99
R0219:Olfr520 UTSW 7 99735928 missense probably benign 0.00
R1931:Olfr520 UTSW 7 99735860 missense possibly damaging 0.73
R6110:Olfr520 UTSW 7 99735170 missense possibly damaging 0.93
R7723:Olfr520 UTSW 7 99735677 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCAGATGTTCCAGCCACCCATGAC -3'
(R):5'- TAGGCCATGACCACCAGGATGAAG -3'

Sequencing Primer
(F):5'- GCTACAACTTGCAATGGGTC -3'
(R):5'- CACCAGGATGAAGGCTTCTGAG -3'
Posted On2014-04-13