Incidental Mutation 'R1577:Chst4'
ID171229
Institutional Source Beutler Lab
Gene Symbol Chst4
Ensembl Gene ENSMUSG00000035930
Gene Namecarbohydrate (chondroitin 6/keratan) sulfotransferase 4
SynonymsGST-3, HEC-GlcNAc6ST, high endothelial cell GlcNAC-6-sulphotransferase
MMRRC Submission 039615-MU
Accession Numbers

Genbank: NM_011998;  MGI: 1349479

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110029153-110039740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110029844 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 379 (H379Q)
Ref Sequence ENSEMBL: ENSMUSP00000104845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109222] [ENSMUST00000211894] [ENSMUST00000212934]
Predicted Effect probably benign
Transcript: ENSMUST00000109222
AA Change: H379Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104845
Gene: ENSMUSG00000035930
AA Change: H379Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sulfotransfer_3 41 296 6.4e-15 PFAM
Pfam:Sulfotransfer_1 41 357 2.4e-26 PFAM
low complexity region 370 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211894
AA Change: H462Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212934
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene do not accumulate lymphocytes in peripheral lymph nodes to as great an extent as normal. The animals are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Chst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Chst4 APN 8 110029965 missense probably benign 0.14
A4554:Chst4 UTSW 8 110029888 missense probably benign 0.09
R0091:Chst4 UTSW 8 110030665 missense probably damaging 1.00
R0373:Chst4 UTSW 8 110030394 missense probably damaging 1.00
R1171:Chst4 UTSW 8 110030623 missense probably damaging 1.00
R2377:Chst4 UTSW 8 110030172 missense possibly damaging 0.80
R3421:Chst4 UTSW 8 110030406 missense probably damaging 1.00
R5514:Chst4 UTSW 8 110029974 missense probably damaging 1.00
R6793:Chst4 UTSW 8 110030067 missense probably damaging 1.00
R7141:Chst4 UTSW 8 110030839 missense probably damaging 1.00
R7146:Chst4 UTSW 8 110030731 missense probably damaging 1.00
R7183:Chst4 UTSW 8 110029998 missense possibly damaging 0.72
R7732:Chst4 UTSW 8 110029882 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACACAAAGACCCCTCTGCTTGG -3'
(R):5'- GCCATGAAGATCATCTGCAAAAGCC -3'

Sequencing Primer
(F):5'- CCCTCTGCTTGGGGCTG -3'
(R):5'- GTGGACATAGTCAAGGCCATCC -3'
Posted On2014-04-13