Incidental Mutation 'R1577:Fgd3'
ID171239
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1577 (G1)
Quality Score102
Status Not validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49281937 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 282 (N282D)
Ref Sequence ENSEMBL: ENSMUSP00000105714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110086] [ENSMUST00000110087]
Predicted Effect probably damaging
Transcript: ENSMUST00000048716
AA Change: N282D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: N282D

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110086
AA Change: N282D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105713
Gene: ENSMUSG00000037946
AA Change: N282D

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110087
AA Change: N282D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: N282D

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0526:Fgd3 UTSW 13 49296524 missense probably benign 0.00
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1529:Fgd3 UTSW 13 49266694 missense probably benign 0.19
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R5753:Fgd3 UTSW 13 49274940 missense possibly damaging 0.94
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
R7383:Fgd3 UTSW 13 49268309 missense possibly damaging 0.50
Z1176:Fgd3 UTSW 13 49281826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGGGGATAACACCAAGTGAG -3'
(R):5'- ATGGGAGGAGGCAGTATCTTGACC -3'

Sequencing Primer
(F):5'- tctctgtctgtttctgtctgtc -3'
(R):5'- AGTTCCTCTATCATTAGGCACctttg -3'
Posted On2014-04-13