Mutagenetix > Incidental Mutation

Incidental Mutation 'R1577:Cntnap3'

171240

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

039615-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R1577 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64758290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 834 (E834G)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: E834G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: E834G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.6%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	C	1: 25,094,183	N404S	possibly damaging	Het
Cep85	T	C	4: 134,152,288	E383G	probably damaging	Het
Chst4	A	T	8: 110,029,844	H379Q	probably benign	Het
Clca3b	A	T	3: 144,823,519	I798N	probably damaging	Het
Cldnd1	T	G	16: 58,732,653	L159R	possibly damaging	Het
Col2a1	C	T	15: 97,979,202	R1065Q	probably damaging	Het
Dchs1	T	C	7: 105,765,955	D674G	probably damaging	Het
Dntt	A	G	19: 41,055,785	Y463C	probably damaging	Het
Egfr	A	G	11: 16,869,241	E257G	probably benign	Het
Eif4b	C	T	15: 102,089,901	R339*	probably null	Het
Fat1	C	T	8: 45,023,383	T1822M	probably benign	Het
Fgd3	T	C	13: 49,281,937	N282D	probably damaging	Het
Fmo4	T	C	1: 162,803,700	M233V	possibly damaging	Het
Gabbr2	T	A	4: 46,684,319	M652L	probably benign	Het
Gal3st2c	G	A	1: 94,006,928	V13M	probably damaging	Het
Gapvd1	C	T	2: 34,709,228	G686D	probably damaging	Het
Gdap1l1	T	G	2: 163,438,604	L20R	probably damaging	Het
Gm5800	A	T	14: 51,714,559	M82K	probably benign	Het
Grm6	T	A	11: 50,863,145	C759S	probably damaging	Het
Hs3st1	A	T	5: 39,615,050	D83E	probably benign	Het
Il12rb1	A	G	8: 70,810,606	D39G	probably damaging	Het
Ldhb	C	A	6: 142,492,598	K244N	possibly damaging	Het
Lypd6	C	T	2: 50,190,698	R133*	probably null	Het
Med13l	G	A	5: 118,721,392	G215S	probably damaging	Het
Ncoa1	T	C	12: 4,295,196	D606G	probably damaging	Het
Noc2l	C	T	4: 156,240,622	T151M	probably damaging	Het
Olfr1107	T	C	2: 87,071,397	T246A	probably benign	Het
Olfr1395	T	A	11: 49,149,189	C311S	probably benign	Het
Olfr1419	T	C	19: 11,870,377	T280A	probably damaging	Het
Olfr520	T	C	7: 99,735,356	L71P	probably damaging	Het
Olfr706	T	C	7: 106,886,010	K269R	probably benign	Het
Ppm1l	G	A	3: 69,553,070	G327R	probably damaging	Het
Rapgef5	C	T	12: 117,595,291	A282V	probably benign	Het
Rnf139	T	C	15: 58,899,518	V464A	probably damaging	Het
Rprd2	C	T	3: 95,764,735	E1119K	probably damaging	Het
Sipa1l2	G	A	8: 125,492,262	T112I	probably benign	Het
Skint6	T	C	4: 113,148,523	T363A	possibly damaging	Het
Slc22a16	G	T	10: 40,603,815	E607*	probably null	Het
Slc24a2	T	C	4: 86,991,411	Y690C	probably damaging	Het
Slc25a23	T	C	17: 57,047,306	S115G	probably benign	Het
Slc4a3	T	C	1: 75,550,891	L168P	probably damaging	Het
Spats2	T	A	15: 99,178,452	I137N	possibly damaging	Het
Stard4	A	T	18: 33,205,098	V133D	probably damaging	Het
Syn3	A	G	10: 86,448,864		probably null	Het
Tfpi	A	G	2: 84,433,103	I305T	probably damaging	Het
Tmtc1	T	A	6: 148,412,820		probably null	Het
Tpcn1	A	C	5: 120,544,420	W508G	probably damaging	Het
Ubr5	A	T	15: 38,030,730	N406K	possibly damaging	Het
Xrcc1	T	A	7: 24,565,627	L118*	probably null	Het
Zbtb5	T	C	4: 44,995,129	Y85C	probably damaging	Het
Zfand4	C	A	6: 116,329,412	Y735*	probably null	Het
Zfp180	G	T	7: 24,105,908	C584F	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTCCATTCCCAACATCAAAAGAAAAGG -3'
(R):5'- TGACATGAAGGTCCAGAACTCCAACTAA -3'

Sequencing Primer
(F):5'- GGCAGTTATAAATTAAGCTTTGGATG -3'
(R):5'- GTCCAGAACTCCAACTAAAAGCTTG -3'

Posted On

2014-04-13