Incidental Mutation 'R1577:Spats2'
ID171246
Institutional Source Beutler Lab
Gene Symbol Spats2
Ensembl Gene ENSMUSG00000051934
Gene Namespermatogenesis associated, serine-rich 2
SynonymsScr59, 59kDa, 2700012F11Rik, p59
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99125916-99213215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99178452 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 137 (I137N)
Ref Sequence ENSEMBL: ENSMUSP00000070549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063517] [ENSMUST00000229066] [ENSMUST00000229073] [ENSMUST00000229147] [ENSMUST00000229663] [ENSMUST00000230628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063517
AA Change: I137N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070549
Gene: ENSMUSG00000051934
AA Change: I137N

DomainStartEndE-ValueType
Pfam:DUF1387 81 385 8.1e-125 PFAM
low complexity region 391 413 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157366
Predicted Effect possibly damaging
Transcript: ENSMUST00000229066
AA Change: I106N

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229073
AA Change: I106N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229147
AA Change: I137N

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229493
Predicted Effect probably benign
Transcript: ENSMUST00000229663
Predicted Effect probably benign
Transcript: ENSMUST00000230628
AA Change: I137N

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Spats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Spats2 APN 15 99180593 missense possibly damaging 0.88
IGL00696:Spats2 APN 15 99210894 missense probably damaging 1.00
IGL01524:Spats2 APN 15 99212246 missense probably benign 0.00
IGL02496:Spats2 APN 15 99173448 missense probably damaging 1.00
IGL03031:Spats2 APN 15 99180688 missense probably benign 0.00
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0630:Spats2 UTSW 15 99186028 unclassified probably null
R2012:Spats2 UTSW 15 99178494 missense probably damaging 0.97
R2229:Spats2 UTSW 15 99174453 critical splice donor site probably null
R2982:Spats2 UTSW 15 99211046 missense probably benign
R3743:Spats2 UTSW 15 99210914 missense probably benign 0.09
R4679:Spats2 UTSW 15 99180722 missense possibly damaging 0.62
R4857:Spats2 UTSW 15 99174420 missense probably damaging 1.00
R4962:Spats2 UTSW 15 99212276 missense probably benign 0.00
R5291:Spats2 UTSW 15 99178541 missense probably benign 0.16
R6879:Spats2 UTSW 15 99173412 missense probably damaging 1.00
R7187:Spats2 UTSW 15 99212173 missense probably benign 0.02
R7476:Spats2 UTSW 15 99212141 missense probably benign 0.00
R8084:Spats2 UTSW 15 99167080 missense possibly damaging 0.94
R8239:Spats2 UTSW 15 99208895 missense probably damaging 1.00
R8338:Spats2 UTSW 15 99178459 missense probably damaging 1.00
X0062:Spats2 UTSW 15 99178532 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGAATTGGTAACGCTGGCTTG -3'
(R):5'- AAGGCACCCCTCTGTTACACAATG -3'

Sequencing Primer
(F):5'- TTAGCTGGCATTGGCCTC -3'
(R):5'- CAGTATGAACTCTTCCATGCAG -3'
Posted On2014-04-13