Incidental Mutation 'R1577:Eif4b'
ID171247
Institutional Source Beutler Lab
Gene Symbol Eif4b
Ensembl Gene ENSMUSG00000058655
Gene Nameeukaryotic translation initiation factor 4B
Synonyms
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102073773-102097173 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 102089901 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 339 (R339*)
Ref Sequence ENSEMBL: ENSMUSP00000155206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169681] [ENSMUST00000229400]
Predicted Effect probably null
Transcript: ENSMUST00000169681
AA Change: R339*
SMART Domains Protein: ENSMUSP00000127774
Gene: ENSMUSG00000058655
AA Change: R339*

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
RRM 97 169 1.54e-15 SMART
low complexity region 221 273 N/A INTRINSIC
low complexity region 282 327 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
low complexity region 408 428 N/A INTRINSIC
low complexity region 574 581 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229254
Predicted Effect probably null
Transcript: ENSMUST00000229400
AA Change: R339*
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Eif4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Eif4b APN 15 102091423 missense probably benign 0.23
IGL01896:Eif4b APN 15 102095286 missense probably benign 0.23
IGL03348:Eif4b APN 15 102093031 unclassified probably benign
R1727:Eif4b UTSW 15 102090062 missense possibly damaging 0.71
R1931:Eif4b UTSW 15 102088976 missense unknown
R3927:Eif4b UTSW 15 102084310 missense probably damaging 1.00
R4051:Eif4b UTSW 15 102086604 missense probably benign 0.31
R4392:Eif4b UTSW 15 102086641 critical splice donor site probably null
R5105:Eif4b UTSW 15 102084196 missense probably benign 0.42
R5716:Eif4b UTSW 15 102082059 missense probably benign 0.36
R6488:Eif4b UTSW 15 102092987 unclassified probably benign
R7048:Eif4b UTSW 15 102093136 unclassified probably benign
R7647:Eif4b UTSW 15 102088694 missense unknown
R7648:Eif4b UTSW 15 102089000 missense unknown
R8145:Eif4b UTSW 15 102092988 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGCCTGCCATGCAGAGAGTG -3'
(R):5'- AGAAGCCCCTTGTTGAAGACGC -3'

Sequencing Primer
(F):5'- GTGAGACTACTCCAGCACTGATG -3'
(R):5'- TGTTGAAGACGCCTCACC -3'
Posted On2014-04-13