Incidental Mutation 'R1577:Slc25a23'
ID171249
Institutional Source Beutler Lab
Gene Symbol Slc25a23
Ensembl Gene ENSMUSG00000046329
Gene Namesolute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1577 (G1)
Quality Score105
Status Not validated
Chromosome17
Chromosomal Location57043711-57059863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57047306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 115 (S115G)
Ref Sequence ENSEMBL: ENSMUSP00000128348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000171528]
Predicted Effect probably benign
Transcript: ENSMUST00000040280
AA Change: S367G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329
AA Change: S367G

DomainStartEndE-ValueType
EFh 13 41 2.72e-3 SMART
EFh 80 108 1.09e0 SMART
EFh 116 144 3.07e1 SMART
Pfam:Mito_carr 181 273 3.8e-25 PFAM
Pfam:Mito_carr 274 366 4.1e-26 PFAM
Pfam:Mito_carr 372 465 6.5e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163442
AA Change: S58G
SMART Domains Protein: ENSMUSP00000132962
Gene: ENSMUSG00000046329
AA Change: S58G

DomainStartEndE-ValueType
Pfam:Mito_carr 1 58 6.5e-15 PFAM
Pfam:Mito_carr 64 123 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169146
Predicted Effect unknown
Transcript: ENSMUST00000170015
AA Change: S166G
SMART Domains Protein: ENSMUSP00000132169
Gene: ENSMUSG00000046329
AA Change: S166G

DomainStartEndE-ValueType
Pfam:Mito_carr 1 76 1.9e-19 PFAM
Pfam:Mito_carr 77 166 1.2e-21 PFAM
Pfam:Mito_carr 172 265 7.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171128
Predicted Effect probably benign
Transcript: ENSMUST00000171528
AA Change: S115G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128348
Gene: ENSMUSG00000046329
AA Change: S115G

DomainStartEndE-ValueType
Pfam:Mito_carr 22 114 8.3e-29 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Stard4 A T 18: 33,205,098 V133D probably damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Slc25a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Slc25a23 APN 17 57047233 missense probably benign 0.01
IGL01614:Slc25a23 APN 17 57045579 missense probably null 0.98
IGL01919:Slc25a23 APN 17 57047291 missense possibly damaging 0.61
IGL01933:Slc25a23 APN 17 57052813 nonsense probably null
IGL02297:Slc25a23 APN 17 57053324 missense probably benign 0.00
R1317:Slc25a23 UTSW 17 57053888 missense possibly damaging 0.63
R1411:Slc25a23 UTSW 17 57059622 missense probably damaging 0.97
R2156:Slc25a23 UTSW 17 57045562 missense probably benign 0.00
R4581:Slc25a23 UTSW 17 57052740 missense probably damaging 0.96
R4755:Slc25a23 UTSW 17 57052794 missense possibly damaging 0.92
R4786:Slc25a23 UTSW 17 57047326 missense possibly damaging 0.68
R4789:Slc25a23 UTSW 17 57059597 missense probably damaging 1.00
R5402:Slc25a23 UTSW 17 57053336 missense probably benign 0.07
R5423:Slc25a23 UTSW 17 57053597 missense probably damaging 0.99
R5478:Slc25a23 UTSW 17 57052780 missense probably damaging 1.00
R5659:Slc25a23 UTSW 17 57045500 unclassified probably benign
R5787:Slc25a23 UTSW 17 57053825 missense probably damaging 1.00
R6417:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6420:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6462:Slc25a23 UTSW 17 57052720 missense probably damaging 1.00
R6830:Slc25a23 UTSW 17 57053804 nonsense probably null
R6858:Slc25a23 UTSW 17 57058171 missense probably damaging 1.00
R7311:Slc25a23 UTSW 17 57052827 missense probably damaging 1.00
R7381:Slc25a23 UTSW 17 57053587 missense probably damaging 1.00
R7491:Slc25a23 UTSW 17 57052822 nonsense probably null
R7543:Slc25a23 UTSW 17 57058106 critical splice donor site probably null
R7646:Slc25a23 UTSW 17 57059759 unclassified probably benign
X0026:Slc25a23 UTSW 17 57055350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGATGGGTAAACAGAAGCCCAGAC -3'
(R):5'- GCTCAAGTAGTGATGCTGAGAGCC -3'

Sequencing Primer
(F):5'- TCCTACACAGTTACGTGGGAG -3'
(R):5'- gagtgcctgcctagaatcc -3'
Posted On2014-04-13