Incidental Mutation 'R1577:Stard4'
Institutional Source Beutler Lab
Gene Symbol Stard4
Ensembl Gene ENSMUSG00000024378
Gene NameStAR-related lipid transfer (START) domain containing 4
MMRRC Submission 039615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1577 (G1)
Quality Score225
Status Not validated
Chromosomal Location33199355-33213862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33205098 bp
Amino Acid Change Valine to Aspartic acid at position 133 (V133D)
Ref Sequence ENSEMBL: ENSMUSP00000025236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025236] [ENSMUST00000118990] [ENSMUST00000119991]
Predicted Effect probably damaging
Transcript: ENSMUST00000025236
AA Change: V133D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025236
Gene: ENSMUSG00000024378
AA Change: V133D

START 25 224 1.43e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118990
SMART Domains Protein: ENSMUSP00000114131
Gene: ENSMUSG00000024378

PDB:1JSS|B 1 110 5e-78 PDB
SCOP:d1jssa_ 24 110 3e-17 SMART
Blast:START 25 110 4e-58 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119991
SMART Domains Protein: ENSMUSP00000114109
Gene: ENSMUSG00000024378

PDB:1JSS|B 1 110 1e-76 PDB
SCOP:d1jssa_ 24 110 8e-17 SMART
Blast:START 25 110 8e-57 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141617
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased liver weight, body weight, and body length. Female mice homozygous for this allele exhibit decreased circulating cholesterol when fed a low cholesterol diet and altered bile composition when fed standard chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,094,183 N404S possibly damaging Het
Cep85 T C 4: 134,152,288 E383G probably damaging Het
Chst4 A T 8: 110,029,844 H379Q probably benign Het
Clca3b A T 3: 144,823,519 I798N probably damaging Het
Cldnd1 T G 16: 58,732,653 L159R possibly damaging Het
Cntnap3 T C 13: 64,758,290 E834G probably damaging Het
Col2a1 C T 15: 97,979,202 R1065Q probably damaging Het
Dchs1 T C 7: 105,765,955 D674G probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Egfr A G 11: 16,869,241 E257G probably benign Het
Eif4b C T 15: 102,089,901 R339* probably null Het
Fat1 C T 8: 45,023,383 T1822M probably benign Het
Fgd3 T C 13: 49,281,937 N282D probably damaging Het
Fmo4 T C 1: 162,803,700 M233V possibly damaging Het
Gabbr2 T A 4: 46,684,319 M652L probably benign Het
Gal3st2c G A 1: 94,006,928 V13M probably damaging Het
Gapvd1 C T 2: 34,709,228 G686D probably damaging Het
Gdap1l1 T G 2: 163,438,604 L20R probably damaging Het
Gm5800 A T 14: 51,714,559 M82K probably benign Het
Grm6 T A 11: 50,863,145 C759S probably damaging Het
Hs3st1 A T 5: 39,615,050 D83E probably benign Het
Il12rb1 A G 8: 70,810,606 D39G probably damaging Het
Ldhb C A 6: 142,492,598 K244N possibly damaging Het
Lypd6 C T 2: 50,190,698 R133* probably null Het
Med13l G A 5: 118,721,392 G215S probably damaging Het
Ncoa1 T C 12: 4,295,196 D606G probably damaging Het
Noc2l C T 4: 156,240,622 T151M probably damaging Het
Olfr1107 T C 2: 87,071,397 T246A probably benign Het
Olfr1395 T A 11: 49,149,189 C311S probably benign Het
Olfr1419 T C 19: 11,870,377 T280A probably damaging Het
Olfr520 T C 7: 99,735,356 L71P probably damaging Het
Olfr706 T C 7: 106,886,010 K269R probably benign Het
Ppm1l G A 3: 69,553,070 G327R probably damaging Het
Rapgef5 C T 12: 117,595,291 A282V probably benign Het
Rnf139 T C 15: 58,899,518 V464A probably damaging Het
Rprd2 C T 3: 95,764,735 E1119K probably damaging Het
Sipa1l2 G A 8: 125,492,262 T112I probably benign Het
Skint6 T C 4: 113,148,523 T363A possibly damaging Het
Slc22a16 G T 10: 40,603,815 E607* probably null Het
Slc24a2 T C 4: 86,991,411 Y690C probably damaging Het
Slc25a23 T C 17: 57,047,306 S115G probably benign Het
Slc4a3 T C 1: 75,550,891 L168P probably damaging Het
Spats2 T A 15: 99,178,452 I137N possibly damaging Het
Syn3 A G 10: 86,448,864 probably null Het
Tfpi A G 2: 84,433,103 I305T probably damaging Het
Tmtc1 T A 6: 148,412,820 probably null Het
Tpcn1 A C 5: 120,544,420 W508G probably damaging Het
Ubr5 A T 15: 38,030,730 N406K possibly damaging Het
Xrcc1 T A 7: 24,565,627 L118* probably null Het
Zbtb5 T C 4: 44,995,129 Y85C probably damaging Het
Zfand4 C A 6: 116,329,412 Y735* probably null Het
Zfp180 G T 7: 24,105,908 C584F probably damaging Het
Other mutations in Stard4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Stard4 UTSW 18 33205149 missense probably damaging 1.00
R1396:Stard4 UTSW 18 33206210 missense probably damaging 0.99
R5308:Stard4 UTSW 18 33203625 missense probably damaging 1.00
R5481:Stard4 UTSW 18 33205245 missense probably benign 0.03
R6161:Stard4 UTSW 18 33209056 missense probably damaging 0.99
R6393:Stard4 UTSW 18 33205225 missense probably benign 0.00
R7062:Stard4 UTSW 18 33205534 splice site probably null
R7478:Stard4 UTSW 18 33205324 missense unknown
R8805:Stard4 UTSW 18 33203696 missense possibly damaging 0.93
X0065:Stard4 UTSW 18 33209072 missense probably damaging 0.98
Z1088:Stard4 UTSW 18 33203717 missense probably benign 0.01
Z1088:Stard4 UTSW 18 33203720 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggtgtgtgaagacagtgacag -3'
Posted On2014-04-13