Incidental Mutation 'R1580:Atp8b5'
ID 171339
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene Name ATPase, class I, type 8B, member 5
Synonyms 4930417M19Rik, FetA
MMRRC Submission 039617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1580 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43267159-43373833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43355673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 551 (V551A)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
AlphaFold A3FIN4
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect possibly damaging
Transcript: ENSMUST00000107942
AA Change: V551A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: V551A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,305,124 (GRCm39) V2044I possibly damaging Het
Adgrv1 A G 13: 81,614,279 (GRCm39) probably null Het
Arhgef38 T C 3: 132,839,465 (GRCm39) Q526R probably benign Het
Atp2c2 A G 8: 120,479,726 (GRCm39) N752D probably benign Het
Atp6v0a1 T C 11: 100,920,030 (GRCm39) I221T probably damaging Het
B3galnt1 A G 3: 69,483,040 (GRCm39) S74P possibly damaging Het
Bcl2l13 A G 6: 120,842,675 (GRCm39) I123V probably benign Het
Brms1l A T 12: 55,915,007 (GRCm39) K305N probably damaging Het
Ccdc82 C T 9: 13,252,385 (GRCm39) R226C probably damaging Het
Chst9 T G 18: 15,586,122 (GRCm39) K147T probably benign Het
Clec16a A G 16: 10,413,762 (GRCm39) R390G probably damaging Het
Clec5a G T 6: 40,562,153 (GRCm39) H4N probably benign Het
Csmd1 T A 8: 15,975,299 (GRCm39) Q2970L probably damaging Het
Cyp2a4 T C 7: 26,007,076 (GRCm39) I61T possibly damaging Het
Cyp3a16 T A 5: 145,378,884 (GRCm39) K379I possibly damaging Het
Cyp3a16 T C 5: 145,378,885 (GRCm39) K379E probably damaging Het
Dok2 A G 14: 71,014,397 (GRCm39) D195G probably benign Het
Emilin1 A G 5: 31,074,764 (GRCm39) E335G probably damaging Het
Gm7361 G T 5: 26,462,768 (GRCm39) L3F probably damaging Het
Haus1 T C 18: 77,854,620 (GRCm39) D50G probably damaging Het
Igf1r T C 7: 67,857,617 (GRCm39) V1099A probably benign Het
Kif15 T C 9: 122,789,021 (GRCm39) V71A probably benign Het
Klk10 C T 7: 43,432,286 (GRCm39) A73V probably damaging Het
Lins1 C A 7: 66,364,239 (GRCm39) D711E probably benign Het
Mbtps1 C T 8: 120,265,639 (GRCm39) V303I possibly damaging Het
Mest G A 6: 30,745,822 (GRCm39) probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or14c43 A G 7: 86,114,658 (GRCm39) E13G probably benign Het
Or6c210 G T 10: 129,496,184 (GRCm39) V170F probably benign Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Sbspon C A 1: 15,962,692 (GRCm39) C62F probably damaging Het
Spata31f3 T C 4: 42,874,020 (GRCm39) probably null Het
Spg7 T A 8: 123,816,977 (GRCm39) probably benign Het
Trabd2b T C 4: 114,437,531 (GRCm39) V236A possibly damaging Het
Vmn2r10 A T 5: 109,154,117 (GRCm39) N62K possibly damaging Het
Vmn2r45 T G 7: 8,474,746 (GRCm39) S761R possibly damaging Het
Zfp580 C T 7: 5,056,284 (GRCm39) R215C probably damaging Het
Zfpm2 A G 15: 40,966,605 (GRCm39) D898G possibly damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43,355,567 (GRCm39) missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43,311,938 (GRCm39) missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43,302,628 (GRCm39) missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43,368,010 (GRCm39) missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43,291,693 (GRCm39) missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43,366,638 (GRCm39) missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43,320,590 (GRCm39) critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43,364,167 (GRCm39) missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43,334,205 (GRCm39) missense probably benign
IGL02456:Atp8b5 APN 4 43,365,578 (GRCm39) missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43,369,634 (GRCm39) missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43,366,770 (GRCm39) missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43,305,774 (GRCm39) missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43,366,057 (GRCm39) missense probably benign
R0256:Atp8b5 UTSW 4 43,302,576 (GRCm39) intron probably benign
R0379:Atp8b5 UTSW 4 43,361,898 (GRCm39) missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43,291,672 (GRCm39) missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43,305,719 (GRCm39) intron probably benign
R1442:Atp8b5 UTSW 4 43,334,313 (GRCm39) missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43,302,590 (GRCm39) missense probably benign
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43,344,430 (GRCm39) missense probably damaging 1.00
R1677:Atp8b5 UTSW 4 43,372,903 (GRCm39) missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43,372,906 (GRCm39) missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43,361,804 (GRCm39) missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43,357,063 (GRCm39) missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43,369,688 (GRCm39) missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43,370,726 (GRCm39) missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43,361,953 (GRCm39) splice site probably benign
R3023:Atp8b5 UTSW 4 43,311,957 (GRCm39) missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43,372,697 (GRCm39) missense probably benign
R3690:Atp8b5 UTSW 4 43,368,055 (GRCm39) missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43,365,591 (GRCm39) missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43,357,016 (GRCm39) missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43,365,955 (GRCm39) missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43,372,710 (GRCm39) missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43,308,504 (GRCm39) makesense probably null
R4784:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43,344,449 (GRCm39) missense probably benign
R5422:Atp8b5 UTSW 4 43,366,644 (GRCm39) missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43,370,577 (GRCm39) missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43,304,674 (GRCm39) missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43,371,003 (GRCm39) missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43,334,249 (GRCm39) missense probably benign
R6931:Atp8b5 UTSW 4 43,364,108 (GRCm39) critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43,355,618 (GRCm39) missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43,361,835 (GRCm39) missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43,357,018 (GRCm39) missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43,342,640 (GRCm39) missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43,366,021 (GRCm39) missense probably benign
R7465:Atp8b5 UTSW 4 43,271,269 (GRCm39) missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43,366,609 (GRCm39) missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43,370,823 (GRCm39) critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43,366,735 (GRCm39) missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43,342,471 (GRCm39) missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43,356,982 (GRCm39) nonsense probably null
R8218:Atp8b5 UTSW 4 43,372,728 (GRCm39) critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43,366,072 (GRCm39) missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43,291,714 (GRCm39) missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43,342,439 (GRCm39) missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43,304,687 (GRCm39) missense
R8942:Atp8b5 UTSW 4 43,353,658 (GRCm39) missense probably damaging 1.00
R9153:Atp8b5 UTSW 4 43,308,493 (GRCm39) utr 3 prime probably benign
R9154:Atp8b5 UTSW 4 43,372,630 (GRCm39) missense probably benign 0.19
R9211:Atp8b5 UTSW 4 43,367,960 (GRCm39) missense probably damaging 0.97
R9361:Atp8b5 UTSW 4 43,369,658 (GRCm39) missense possibly damaging 0.80
R9786:Atp8b5 UTSW 4 43,305,798 (GRCm39) missense probably damaging 0.97
X0025:Atp8b5 UTSW 4 43,366,774 (GRCm39) missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43,361,903 (GRCm39) missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43,370,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCCTTTGTGTCAGCCACTGGAAAC -3'
(R):5'- GGACATAGCACTTGCAGTAATCCCC -3'

Sequencing Primer
(F):5'- CAGCCACTGGAAACATGGTTTTAC -3'
(R):5'- ATCCCCTATTTATGCACAGGAG -3'
Posted On 2014-04-13