Incidental Mutation 'R1580:Clec5a'
ID171346
Institutional Source Beutler Lab
Gene Symbol Clec5a
Ensembl Gene ENSMUSG00000029915
Gene NameC-type lectin domain family 5, member a
Synonymsmyeloid DAP12-associating lectin-1, MDL-1, Ly100, Clecsf5
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40574894-40585821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40585219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 4 (H4N)
Ref Sequence ENSEMBL: ENSMUSP00000121848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101491] [ENSMUST00000129948] [ENSMUST00000177178]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031975
Predicted Effect probably benign
Transcript: ENSMUST00000101491
AA Change: H4N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099030
Gene: ENSMUSG00000029915
AA Change: H4N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
CLECT 48 161 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129948
AA Change: H4N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121848
Gene: ENSMUSG00000029915
AA Change: H4N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
internal_repeat_1 29 51 5.12e-5 PROSPERO
CLECT 73 186 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177178
AA Change: H4N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000135240
Gene: ENSMUSG00000029915
AA Change: H4N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
CLECT 48 160 9.02e-18 SMART
Meta Mutation Damage Score 0.1791 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein interacts with dnax-activation protein 12 and may play a role in cell activation. Alternative splice variants have been described but their full-length sequence has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Clec5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Clec5a APN 6 40582262 missense probably benign 0.01
IGL01680:Clec5a APN 6 40584380 missense probably benign 0.01
IGL01701:Clec5a APN 6 40582226 splice site probably benign
IGL02281:Clec5a APN 6 40584402 missense probably benign 0.04
IGL02799:Clec5a UTSW 6 40578049 missense probably damaging 1.00
R1435:Clec5a UTSW 6 40584424 missense probably damaging 1.00
R1752:Clec5a UTSW 6 40582253 missense probably damaging 1.00
R1898:Clec5a UTSW 6 40581936 missense probably benign 0.03
R2022:Clec5a UTSW 6 40585194 missense probably damaging 0.99
R2110:Clec5a UTSW 6 40585203 missense probably damaging 0.96
R4915:Clec5a UTSW 6 40585231 utr 5 prime probably benign
R5697:Clec5a UTSW 6 40582270 missense probably benign 0.00
R5906:Clec5a UTSW 6 40581859 missense probably benign 0.07
R7811:Clec5a UTSW 6 40581933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAAGAACTTGGGCACTGAAC -3'
(R):5'- TGCTCGCTGCACCGAATATCTTATC -3'

Sequencing Primer
(F):5'- GAACTTGGGCACTGAACCTTTAC -3'
(R):5'- TCTGACATACTTGAGACTGGAGC -3'
Posted On2014-04-13