Incidental Mutation 'R1580:Lins1'
ID171353
Institutional Source Beutler Lab
Gene Symbol Lins1
Ensembl Gene ENSMUSG00000053091
Gene Namelines homolog 1
SynonymsWins2, Lins, 2700083B01Rik
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66689889-66717256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66714491 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 711 (D711E)
Ref Sequence ENSEMBL: ENSMUSP00000112404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065323] [ENSMUST00000077967] [ENSMUST00000121777] [ENSMUST00000130161] [ENSMUST00000133771] [ENSMUST00000153773]
Predicted Effect probably benign
Transcript: ENSMUST00000065323
Predicted Effect probably benign
Transcript: ENSMUST00000077967
AA Change: D706E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077117
Gene: ENSMUSG00000053091
AA Change: D706E

DomainStartEndE-ValueType
Pfam:LINES_N 204 554 1.6e-119 PFAM
low complexity region 641 652 N/A INTRINSIC
low complexity region 684 699 N/A INTRINSIC
Pfam:LINES_C 717 755 5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121777
AA Change: D711E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112404
Gene: ENSMUSG00000053091
AA Change: D711E

DomainStartEndE-ValueType
Pfam:LINES_N 210 558 9.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
Pfam:LINES_C 723 759 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128486
Predicted Effect probably benign
Transcript: ENSMUST00000130161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132181
Predicted Effect probably benign
Transcript: ENSMUST00000132351
SMART Domains Protein: ENSMUSP00000115180
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 155 244 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133199
SMART Domains Protein: ENSMUSP00000115124
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 1 220 3.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133771
Predicted Effect probably benign
Transcript: ENSMUST00000153773
SMART Domains Protein: ENSMUSP00000119187
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 75 229 1.3e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Drosophila segment polarity gene lin encodes a protein, lines, which plays important roles in development of the epidermis and hindgut. This gene encodes a protein containing a lines-like domain. This gene is located on chromosome 15 and clustered with the gene encoding ankyrin repeat and SOCS box-containing protein 7. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Lins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lins1 APN 7 66714531 nonsense probably null
IGL01402:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01404:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01887:Lins1 APN 7 66710381 missense probably damaging 0.98
IGL02887:Lins1 APN 7 66714183 missense probably damaging 0.99
R0089:Lins1 UTSW 7 66712048 unclassified probably benign
R1473:Lins1 UTSW 7 66712046 critical splice donor site probably null
R1556:Lins1 UTSW 7 66710637 nonsense probably null
R1794:Lins1 UTSW 7 66711909 missense probably damaging 1.00
R1848:Lins1 UTSW 7 66714322 missense probably damaging 0.98
R3969:Lins1 UTSW 7 66708198 missense probably benign 0.31
R4760:Lins1 UTSW 7 66714687 unclassified probably benign
R4766:Lins1 UTSW 7 66710641 missense possibly damaging 0.92
R4811:Lins1 UTSW 7 66708150 missense probably benign 0.00
R4941:Lins1 UTSW 7 66709450 splice site probably benign
R5419:Lins1 UTSW 7 66708095 unclassified probably benign
R6140:Lins1 UTSW 7 66711924 missense probably damaging 1.00
R6258:Lins1 UTSW 7 66710748 critical splice donor site probably null
R6713:Lins1 UTSW 7 66708482 missense probably benign 0.00
R6787:Lins1 UTSW 7 66714154 missense probably benign 0.32
R7176:Lins1 UTSW 7 66713805 missense probably benign 0.10
R7455:Lins1 UTSW 7 66711944 missense probably benign 0.14
R7761:Lins1 UTSW 7 66714105 nonsense probably null
Z1176:Lins1 UTSW 7 66710264 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGATGCCCAAGGAAACTCTCCCAG -3'
(R):5'- TACCCAGGGCTCAGACGTTAACAC -3'

Sequencing Primer
(F):5'- CACCGCAGAGTCTGGTAGATTATG -3'
(R):5'- GGCTCAGACGTTAACACACTTG -3'
Posted On2014-04-13