Incidental Mutation 'R1580:Mbtps1'
ID171358
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
MMRRC Submission 039617-MU
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119538900 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 303 (V303I)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081381
AA Change: V303I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: V303I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098362
AA Change: V303I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: V303I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1269:Mbtps1 UTSW 8 119520277 missense probably damaging 1.00
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1715:Mbtps1 UTSW 8 119542730 missense probably benign 0.40
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2910:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4611:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6056:Mbtps1 UTSW 8 119515602 missense probably benign
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
R7215:Mbtps1 UTSW 8 119524568 missense possibly damaging 0.82
R7275:Mbtps1 UTSW 8 119542750 missense probably benign
R7794:Mbtps1 UTSW 8 119538884 missense probably damaging 1.00
R8029:Mbtps1 UTSW 8 119547805 start gained probably benign
RF019:Mbtps1 UTSW 8 119525550 missense probably damaging 1.00
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACCGTCTGTTTCACAAAGCTG -3'
(R):5'- GCCCACTTCTTGGTGCAGGTTC -3'

Sequencing Primer
(F):5'- CAAAGCTGTCATTACCTCAGTG -3'
(R):5'- CGTGCTTTGCTTGGAACTTC -3'
Posted On2014-04-13