Mutagenetix > Incidental Mutation

Incidental Mutation 'R1580:Kif15'

171362

Institutional Source

Beutler Lab

Gene Symbol

Kif15

Ensembl Gene

ENSMUSG00000036768

Gene Name

kinesin family member 15

Synonyms

HKLP2, Knsl7, N-10 kinesin

MMRRC Submission

039617-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1580 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122951046-123018733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122959956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 71 (V71A)

Ref Sequence

ENSEMBL: ENSMUSP00000149737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000213745] [ENSMUST00000214652] [ENSMUST00000216388] [ENSMUST00000217401]

AlphaFold

Q6P9L6

Predicted Effect

probably benign
Transcript: ENSMUST00000040717
AA Change: V71A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: V71A

Domain	Start	End	E-Value	Type
KISc	24	371	2.86e-179	SMART
Pfam:Kinesin-relat_1	463	551	6.6e-26	PFAM
coiled coil region	579	643	N/A	INTRINSIC
coiled coil region	706	1037	N/A	INTRINSIC
coiled coil region	1065	1133	N/A	INTRINSIC
Pfam:HMMR_C	1265	1387	3.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213745
AA Change: V71A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214921

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215176

Predicted Effect

probably benign
Transcript: ENSMUST00000216388

Predicted Effect

probably benign
Transcript: ENSMUST00000217401
AA Change: V71A

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.4%
20x: 89.8%

Validation Efficiency

96% (43/45)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,265,965	V2044I	possibly damaging	Het
Adgrv1	A	G	13: 81,466,160		probably null	Het
Arhgef38	T	C	3: 133,133,704	Q526R	probably benign	Het
Atp2c2	A	G	8: 119,752,987	N752D	probably benign	Het
Atp6v0a1	T	C	11: 101,029,204	I221T	probably damaging	Het
Atp8b5	T	C	4: 43,355,673	V551A	possibly damaging	Het
B3galnt1	A	G	3: 69,575,707	S74P	possibly damaging	Het
Bcl2l13	A	G	6: 120,865,714	I123V	probably benign	Het
Brms1l	A	T	12: 55,868,222	K305N	probably damaging	Het
Ccdc82	C	T	9: 13,252,760	R226C	probably damaging	Het
Chst9	T	G	18: 15,453,065	K147T	probably benign	Het
Clec16a	A	G	16: 10,595,898	R390G	probably damaging	Het
Clec5a	G	T	6: 40,585,219	H4N	probably benign	Het
Csmd1	T	A	8: 15,925,299	Q2970L	probably damaging	Het
Cyp2a4	T	C	7: 26,307,651	I61T	possibly damaging	Het
Cyp3a16	T	A	5: 145,442,074	K379I	possibly damaging	Het
Cyp3a16	T	C	5: 145,442,075	K379E	probably damaging	Het
Dok2	A	G	14: 70,776,957	D195G	probably benign	Het
Emilin1	A	G	5: 30,917,420	E335G	probably damaging	Het
Fam205c	T	C	4: 42,874,020		probably null	Het
Gm7361	G	T	5: 26,257,770	L3F	probably damaging	Het
Haus1	T	C	18: 77,766,920	D50G	probably damaging	Het
Igf1r	T	C	7: 68,207,869	V1099A	probably benign	Het
Klk10	C	T	7: 43,782,862	A73V	probably damaging	Het
Lins1	C	A	7: 66,714,491	D711E	probably benign	Het
Mbtps1	C	T	8: 119,538,900	V303I	possibly damaging	Het
Mest	G	A	6: 30,745,823		probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr299	A	G	7: 86,465,450	E13G	probably benign	Het
Olfr800	G	T	10: 129,660,315	V170F	probably benign	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Sbspon	C	A	1: 15,892,468	C62F	probably damaging	Het
Spg7	T	A	8: 123,090,238		probably benign	Het
Trabd2b	T	C	4: 114,580,334	V236A	possibly damaging	Het
Vmn2r10	A	T	5: 109,006,251	N62K	possibly damaging	Het
Vmn2r45	T	G	7: 8,471,747	S761R	possibly damaging	Het
Zfp580	C	T	7: 5,053,285	R215C	probably damaging	Het
Zfpm2	A	G	15: 41,103,209	D898G	possibly damaging	Het

Other mutations in Kif15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01459:Kif15	APN	9	122975755	missense	probably damaging	1.00
IGL01577:Kif15	APN	9	122996334	missense	probably benign	0.06
IGL01647:Kif15	APN	9	122963471	intron	probably benign
IGL01921:Kif15	APN	9	122979504	missense	probably damaging	1.00
IGL02040:Kif15	APN	9	123017385	missense	probably damaging	0.99
IGL02191:Kif15	APN	9	122975679	missense	probably damaging	1.00
IGL02218:Kif15	APN	9	122995827	splice site	probably benign
IGL02537:Kif15	APN	9	122993849	missense	probably benign	0.08
IGL02814:Kif15	APN	9	123003640	missense	possibly damaging	0.83
PIT4480001:Kif15	UTSW	9	123011543	missense	probably benign
R0034:Kif15	UTSW	9	122999285	missense	possibly damaging	0.47
R0458:Kif15	UTSW	9	123009359	missense	probably benign
R0526:Kif15	UTSW	9	122997797	missense	probably damaging	0.96
R0533:Kif15	UTSW	9	123009433	unclassified	probably benign
R0726:Kif15	UTSW	9	122959928	missense	probably benign	0.21
R1597:Kif15	UTSW	9	122994009	missense	probably benign	0.22
R2096:Kif15	UTSW	9	122986187	missense	probably damaging	1.00
R3125:Kif15	UTSW	9	122987961	missense	probably damaging	0.99
R3176:Kif15	UTSW	9	122987840	splice site	probably benign
R4088:Kif15	UTSW	9	122986189	missense	probably benign	0.29
R4308:Kif15	UTSW	9	123013982	missense	probably benign	0.00
R4597:Kif15	UTSW	9	122993849	missense	probably benign	0.08
R4705:Kif15	UTSW	9	122959993	splice site	probably null
R4832:Kif15	UTSW	9	123002126	splice site	probably null
R5100:Kif15	UTSW	9	122991994	missense	probably damaging	0.98
R5126:Kif15	UTSW	9	122975758	missense	probably damaging	1.00
R5180:Kif15	UTSW	9	122999210	missense	probably damaging	0.99
R5247:Kif15	UTSW	9	122986442	missense	possibly damaging	0.65
R5376:Kif15	UTSW	9	122993971	missense	probably benign	0.04
R5392:Kif15	UTSW	9	122996295	missense	probably damaging	0.99
R5422:Kif15	UTSW	9	122984889	splice site	probably null
R5562:Kif15	UTSW	9	122978016	missense	probably damaging	1.00
R5663:Kif15	UTSW	9	122991851	splice site	probably null
R5767:Kif15	UTSW	9	123013974	missense	possibly damaging	0.78
R5927:Kif15	UTSW	9	123017261	missense	probably benign	0.00
R6049:Kif15	UTSW	9	123011622	missense	probably damaging	0.98
R6435:Kif15	UTSW	9	122986491	missense	probably damaging	1.00
R7040:Kif15	UTSW	9	123011614	missense	possibly damaging	0.67
R7158:Kif15	UTSW	9	122999314	missense	probably benign
R7163:Kif15	UTSW	9	123017657	missense	probably damaging	1.00
R7197:Kif15	UTSW	9	123009926	critical splice donor site	probably null
R7318:Kif15	UTSW	9	122987949	missense	probably damaging	1.00
R7360:Kif15	UTSW	9	122991137	missense	probably benign
R8039:Kif15	UTSW	9	123007425	missense	possibly damaging	0.82
R8228:Kif15	UTSW	9	122991976	missense	possibly damaging	0.82
R8549:Kif15	UTSW	9	122986171	missense	probably benign
R9001:Kif15	UTSW	9	122997790	missense	probably benign	0.00
R9031:Kif15	UTSW	9	123017427	intron	probably benign
R9044:Kif15	UTSW	9	123011716	missense	probably benign	0.01
R9063:Kif15	UTSW	9	123004641	missense	probably damaging	1.00
R9306:Kif15	UTSW	9	122977991	missense	probably damaging	1.00
R9490:Kif15	UTSW	9	122959138	missense	probably benign	0.10
R9554:Kif15	UTSW	9	122999520	missense	probably damaging	1.00
R9682:Kif15	UTSW	9	122986647	missense	probably damaging	0.98
R9752:Kif15	UTSW	9	122995825	critical splice donor site	probably null
Z1177:Kif15	UTSW	9	122951051	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGGCAAGCTGAGATTCTGGTG -3'
(R):5'- ATTCACACAGTGGCAAGACTGAGG -3'

Sequencing Primer
(F):5'- AGCTTCTTTCCCCAGGAAAC -3'
(R):5'- AACCTGGAGACTTGCTCATGTC -3'

Posted On

2014-04-13