Incidental Mutation 'R1580:Brms1l'
ID171365
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Namebreast cancer metastasis-suppressor 1-like
SynonymsD12Ertd407e, BRMS1, 0710008O11Rik
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55836324-55869736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55868222 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 305 (K305N)
Ref Sequence ENSEMBL: ENSMUSP00000082500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
Predicted Effect probably damaging
Transcript: ENSMUST00000059250
AA Change: K305N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: K305N

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219575
Meta Mutation Damage Score 0.3705 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55845326 missense probably benign 0.15
IGL00951:Brms1l APN 12 55866049 missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55861172 critical splice donor site probably benign
IGL02669:Brms1l APN 12 55841616 missense probably damaging 1.00
IGL03158:Brms1l APN 12 55836535 missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55868277 makesense probably null
R0445:Brms1l UTSW 12 55861406 nonsense probably null
R0568:Brms1l UTSW 12 55861388 critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55865957 missense probably benign 0.00
R0968:Brms1l UTSW 12 55866013 missense possibly damaging 0.73
R1240:Brms1l UTSW 12 55844508 missense probably damaging 1.00
R1694:Brms1l UTSW 12 55841600 missense probably damaging 1.00
R1926:Brms1l UTSW 12 55863161 missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55863173 missense probably benign 0.01
R4669:Brms1l UTSW 12 55841571 missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55866015 missense probably benign 0.15
R6010:Brms1l UTSW 12 55868200 missense possibly damaging 0.55
R6129:Brms1l UTSW 12 55868185 missense probably benign 0.03
R7429:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7430:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7510:Brms1l UTSW 12 55845322 nonsense probably null
R7543:Brms1l UTSW 12 55868212 missense probably damaging 1.00
R7855:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
R7938:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTGGTAAGTAAACGTGCTGAGCC -3'
(R):5'- TGCACGGTAGTCCATTAGAGGTGAG -3'

Sequencing Primer
(F):5'- TAAACGTGCTGAGCCTACTG -3'
(R):5'- GGTCTACTTGGAGTACTACCTAGAAG -3'
Posted On2014-04-13