Mutagenetix > Incidental Mutations

Incidental Mutation 'R1581:Nup214'

171375

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

039618-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1581 (G1)

Quality Score

132

Status

Not validated

Chromosome

Chromosomal Location

31974436-32053975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32034466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 1669 (S1669F)

Ref Sequence

ENSEMBL: ENSMUSP00000066492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]

AlphaFold

Q80U93

Predicted Effect

probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123062

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

Domain	Start	End	E-Value	Type
low complexity region	54	68	N/A	INTRINSIC
low complexity region	106	137	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
low complexity region	181	210	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC
low complexity region	266	278	N/A	INTRINSIC
low complexity region	294	327	N/A	INTRINSIC
low complexity region	348	368	N/A	INTRINSIC
low complexity region	373	382	N/A	INTRINSIC
low complexity region	394	406	N/A	INTRINSIC
low complexity region	421	430	N/A	INTRINSIC
low complexity region	465	491	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	544	572	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	C	15: 91,179,144	E447G	probably benign	Het
Actn4	T	C	7: 28,898,646	T510A	probably benign	Het
Adgrb3	A	G	1: 25,094,072	M1311T	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bicdl1	G	T	5: 115,651,267		probably benign	Het
Bmyc	T	C	2: 25,707,334	S137P	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Casc3	C	T	11: 98,822,818	T292I	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cnnm2	A	G	19: 46,763,123	T451A	probably damaging	Het
Eed	T	C	7: 89,980,468	K20E	possibly damaging	Het
Eps15	T	A	4: 109,363,186	M180K	probably benign	Het
Esr1	T	C	10: 4,997,905	I486T	probably damaging	Het
Etnppl	A	G	3: 130,628,744	I207V	possibly damaging	Het
Fam92a	T	A	4: 12,155,745		probably null	Het
Fancg	G	A	4: 43,007,039	P246L	probably damaging	Het
Fcrl1	G	A	3: 87,385,723	C249Y	possibly damaging	Het
Foxred2	A	G	15: 77,955,761	F110L	possibly damaging	Het
Fsip2	A	T	2: 82,986,282	N4120Y	probably damaging	Het
Gm156	T	C	6: 129,775,833	D3G	probably benign	Het
Gm4884	C	T	7: 41,043,831	S408L	probably benign	Het
Gm9476	T	C	10: 100,306,612		noncoding transcript	Het
Gria1	T	C	11: 57,237,010		probably null	Het
H6pd	T	A	4: 149,982,514	I472F	possibly damaging	Het
Hydin	A	T	8: 110,410,460	M632L	probably benign	Het
Hyou1	C	T	9: 44,388,870	P819S	probably damaging	Het
Il6st	A	G	13: 112,481,541	E163G	probably damaging	Het
Kcnk1	T	C	8: 125,995,539	V27A	possibly damaging	Het
Kdelr3	T	C	15: 79,522,913		probably null	Het
Klk1b22	A	G	7: 44,115,975	N117S	possibly damaging	Het
Lpp	C	A	16: 24,681,841	C134*	probably null	Het
Lrrc37a	G	A	11: 103,457,017	R2951*	probably null	Het
Luzp2	T	A	7: 55,249,490	D285E	possibly damaging	Het
Ly75	C	T	2: 60,327,893	R1016H	probably damaging	Het
Mesp2	T	A	7: 79,812,541	S282T	possibly damaging	Het
Nav3	T	C	10: 109,823,428	D776G	probably damaging	Het
Nr2e1	T	C	10: 42,567,968	T253A	probably benign	Het
Olfr398	A	T	11: 73,984,521	L29H	probably damaging	Het
Padi6	T	C	4: 140,735,836	Y146C	probably damaging	Het
Pank4	C	T	4: 154,974,651	R414W	probably damaging	Het
Pclo	T	G	5: 14,521,282	I227S	probably benign	Het
Plppr4	A	G	3: 117,328,266	V221A	possibly damaging	Het
Pradc1	G	A	6: 85,448,586	R25C	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rnd2	A	G	11: 101,471,196	T192A	probably benign	Het
Rtbdn	A	G	8: 84,955,066	E131G	probably benign	Het
Ryr2	A	G	13: 11,794,563	V792A	probably benign	Het
Sacs	G	T	14: 61,213,679	Q4391H	probably damaging	Het
Scd2	A	G	19: 44,298,099	S123G	probably benign	Het
Sept9	A	G	11: 117,290,595	R74G	probably damaging	Het
Sipa1l2	T	A	8: 125,491,617	Q327L	probably damaging	Het
Skor1	T	C	9: 63,146,223	T127A	probably damaging	Het
Sphk2	A	G	7: 45,713,496	V57A	probably damaging	Het
Tfec	A	T	6: 16,844,244	D101E	probably damaging	Het
Tmem43	T	A	6: 91,478,735	H109Q	probably benign	Het
Tmem67	C	A	4: 12,047,814	S839I	probably damaging	Het
Trpv5	T	C	6: 41,653,140	Y672C	probably damaging	Het
Ttc39d	A	C	17: 80,216,484	S191R	probably benign	Het
Ttll1	C	T	15: 83,496,277	V296M	probably damaging	Het
Upp2	A	C	2: 58,774,165	K130T	possibly damaging	Het
Vmn2r5	A	G	3: 64,491,219	C780R	probably damaging	Het
Wars	C	A	12: 108,875,709	E171*	probably null	Het
Zeb2	A	T	2: 44,997,000	S637T	probably damaging	Het
Zfp27	T	A	7: 29,896,124	T139S	possibly damaging	Het
Zfp941	A	T	7: 140,812,120	L442Q	probably benign	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	32033979	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	32006721	missense	probably benign	0.27
IGL01149:Nup214	APN	2	32034700	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	32038178	unclassified	probably benign
IGL01409:Nup214	APN	2	32026931	splice site	probably null
IGL01530:Nup214	APN	2	32033721	missense	probably benign
IGL01554:Nup214	APN	2	32051072	nonsense	probably null
IGL01944:Nup214	APN	2	32034959	nonsense	probably null
IGL02296:Nup214	APN	2	31988188	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31977860	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	32031275	missense	probably benign
IGL02858:Nup214	APN	2	32010372	splice site	probably benign
IGL02953:Nup214	APN	2	31988229	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	32018242	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31996440	missense	probably benign	0.27
IGL03225:Nup214	APN	2	32034411	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	32010221	missense	probably damaging	0.97
Des_moines	UTSW	2	31980584	splice site	probably null
ANU74:Nup214	UTSW	2	32034966	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31990367	splice site	probably null
R0243:Nup214	UTSW	2	31998057	splice site	probably benign
R0270:Nup214	UTSW	2	32034814	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	32004300	splice site	probably null
R1168:Nup214	UTSW	2	32025301	missense	probably benign
R1242:Nup214	UTSW	2	31977770	missense	probably benign	0.00
R1481:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31996380	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	32026875	missense	probably benign
R2924:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31976620	missense	probably benign	0.00
R3426:Nup214	UTSW	2	32033403	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	32034682	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	32051100	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31994684	missense	probably benign
R4353:Nup214	UTSW	2	31977917	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31997965	missense	probably benign	0.36
R4626:Nup214	UTSW	2	32033404	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31980584	splice site	probably null
R4938:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31991317	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	32017146	missense	unknown
R5406:Nup214	UTSW	2	32002607	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31988176	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	32034373	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	32010296	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31991341	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31979778	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	32051796	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	32002932	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31991372	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31982671	nonsense	probably null
R6970:Nup214	UTSW	2	32051798	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	32034156	missense	probably benign	0.22
R7114:Nup214	UTSW	2	32025244	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	32051042	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31988233	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	32026905	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	32033350	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31994726	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31996446	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31990254	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8785:Nup214	UTSW	2	32034453	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	32033335	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31977794	missense	probably benign	0.00
R9376:Nup214	UTSW	2	32034232	missense	probably benign	0.00
R9408:Nup214	UTSW	2	32047511	missense	probably damaging	1.00
RF015:Nup214	UTSW	2	32034706	missense	probably benign	0.00
X0026:Nup214	UTSW	2	32020306	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	32042476	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	32011223	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	32010258	missense	possibly damaging	0.66
Z1176:Nup214	UTSW	2	32034225	nonsense	probably null
Z1177:Nup214	UTSW	2	31997959	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCATCTCTGCAAACTTCTGACCCTG -3'
(R):5'- AATGCTGTCTGTCCGAACACTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTTCTTGTGCAGAC -3'
(R):5'- CTCCAGGAGCTGAAGCAC -3'

Posted On

2014-04-13