Incidental Mutation 'R1581:Nup214'
ID 171375
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Name nucleoporin 214
Synonyms CAN, D2H9S46E
MMRRC Submission 039618-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1581 (G1)
Quality Score 132
Status Not validated
Chromosome 2
Chromosomal Location 31864446-31943204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31924478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1669 (S1669F)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]
AlphaFold Q80U93
Predicted Effect probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123062
Predicted Effect possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

DomainStartEndE-ValueType
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 137 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 181 210 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
low complexity region 294 327 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 373 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 544 572 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,063,347 (GRCm39) E447G probably benign Het
Actn4 T C 7: 28,598,071 (GRCm39) T510A probably benign Het
Adgrb3 A G 1: 25,133,153 (GRCm39) M1311T possibly damaging Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bicdl1 G T 5: 115,789,326 (GRCm39) probably benign Het
Bmyc T C 2: 25,597,346 (GRCm39) S137P probably damaging Het
Camsap3 C T 8: 3,654,708 (GRCm39) R782C probably damaging Het
Casc3 C T 11: 98,713,644 (GRCm39) T292I possibly damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Cibar1 T A 4: 12,155,745 (GRCm39) probably null Het
Cnnm2 A G 19: 46,751,562 (GRCm39) T451A probably damaging Het
Eed T C 7: 89,629,676 (GRCm39) K20E possibly damaging Het
Eps15 T A 4: 109,220,383 (GRCm39) M180K probably benign Het
Esr1 T C 10: 4,947,905 (GRCm39) I486T probably damaging Het
Etnppl A G 3: 130,422,393 (GRCm39) I207V possibly damaging Het
Fancg G A 4: 43,007,039 (GRCm39) P246L probably damaging Het
Fcrl1 G A 3: 87,293,030 (GRCm39) C249Y possibly damaging Het
Foxred2 A G 15: 77,839,961 (GRCm39) F110L possibly damaging Het
Fsip2 A T 2: 82,816,626 (GRCm39) N4120Y probably damaging Het
Gm4884 C T 7: 40,693,255 (GRCm39) S408L probably benign Het
Gm9476 T C 10: 100,142,474 (GRCm39) noncoding transcript Het
Gria1 T C 11: 57,127,836 (GRCm39) probably null Het
H6pd T A 4: 150,066,971 (GRCm39) I472F possibly damaging Het
Hydin A T 8: 111,137,092 (GRCm39) M632L probably benign Het
Hyou1 C T 9: 44,300,167 (GRCm39) P819S probably damaging Het
Il6st A G 13: 112,618,075 (GRCm39) E163G probably damaging Het
Kcnk1 T C 8: 126,722,278 (GRCm39) V27A possibly damaging Het
Kdelr3 T C 15: 79,407,114 (GRCm39) probably null Het
Klk1b22 A G 7: 43,765,399 (GRCm39) N117S possibly damaging Het
Klrh1 T C 6: 129,752,796 (GRCm39) D3G probably benign Het
Lpp C A 16: 24,500,591 (GRCm39) C134* probably null Het
Lrrc37a G A 11: 103,347,843 (GRCm39) R2951* probably null Het
Luzp2 T A 7: 54,899,238 (GRCm39) D285E possibly damaging Het
Ly75 C T 2: 60,158,237 (GRCm39) R1016H probably damaging Het
Mesp2 T A 7: 79,462,289 (GRCm39) S282T possibly damaging Het
Nav3 T C 10: 109,659,289 (GRCm39) D776G probably damaging Het
Nr2e1 T C 10: 42,443,964 (GRCm39) T253A probably benign Het
Or1r1 A T 11: 73,875,347 (GRCm39) L29H probably damaging Het
Padi6 T C 4: 140,463,147 (GRCm39) Y146C probably damaging Het
Pank4 C T 4: 155,059,108 (GRCm39) R414W probably damaging Het
Pclo T G 5: 14,571,296 (GRCm39) I227S probably benign Het
Plppr4 A G 3: 117,121,915 (GRCm39) V221A possibly damaging Het
Pradc1 G A 6: 85,425,568 (GRCm39) R25C probably damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rnd2 A G 11: 101,362,022 (GRCm39) T192A probably benign Het
Rtbdn A G 8: 85,681,695 (GRCm39) E131G probably benign Het
Ryr2 A G 13: 11,809,449 (GRCm39) V792A probably benign Het
Sacs G T 14: 61,451,128 (GRCm39) Q4391H probably damaging Het
Scd2 A G 19: 44,286,538 (GRCm39) S123G probably benign Het
Septin9 A G 11: 117,181,421 (GRCm39) R74G probably damaging Het
Sipa1l2 T A 8: 126,218,356 (GRCm39) Q327L probably damaging Het
Skor1 T C 9: 63,053,505 (GRCm39) T127A probably damaging Het
Sphk2 A G 7: 45,362,920 (GRCm39) V57A probably damaging Het
Tfec A T 6: 16,844,243 (GRCm39) D101E probably damaging Het
Tmem43 T A 6: 91,455,717 (GRCm39) H109Q probably benign Het
Tmem67 C A 4: 12,047,814 (GRCm39) S839I probably damaging Het
Trpv5 T C 6: 41,630,074 (GRCm39) Y672C probably damaging Het
Ttc39d A C 17: 80,523,913 (GRCm39) S191R probably benign Het
Ttll1 C T 15: 83,380,478 (GRCm39) V296M probably damaging Het
Upp2 A C 2: 58,664,177 (GRCm39) K130T possibly damaging Het
Vmn2r5 A G 3: 64,398,640 (GRCm39) C780R probably damaging Het
Wars1 C A 12: 108,841,635 (GRCm39) E171* probably null Het
Zeb2 A T 2: 44,887,012 (GRCm39) S637T probably damaging Het
Zfp27 T A 7: 29,595,549 (GRCm39) T139S possibly damaging Het
Zfp941 A T 7: 140,392,033 (GRCm39) L442Q probably benign Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 31,923,991 (GRCm39) missense probably damaging 1.00
IGL00649:Nup214 APN 2 31,896,733 (GRCm39) missense probably benign 0.27
IGL01149:Nup214 APN 2 31,924,712 (GRCm39) missense probably damaging 1.00
IGL01360:Nup214 APN 2 31,928,190 (GRCm39) unclassified probably benign
IGL01409:Nup214 APN 2 31,916,943 (GRCm39) splice site probably null
IGL01530:Nup214 APN 2 31,923,733 (GRCm39) missense probably benign
IGL01554:Nup214 APN 2 31,941,084 (GRCm39) nonsense probably null
IGL01944:Nup214 APN 2 31,924,971 (GRCm39) nonsense probably null
IGL02296:Nup214 APN 2 31,878,200 (GRCm39) missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31,867,872 (GRCm39) missense probably damaging 1.00
IGL02688:Nup214 APN 2 31,921,287 (GRCm39) missense probably benign
IGL02858:Nup214 APN 2 31,900,384 (GRCm39) splice site probably benign
IGL02953:Nup214 APN 2 31,878,241 (GRCm39) missense possibly damaging 0.87
IGL03090:Nup214 APN 2 31,908,254 (GRCm39) missense probably benign 0.01
IGL03124:Nup214 APN 2 31,886,452 (GRCm39) missense probably benign 0.27
IGL03225:Nup214 APN 2 31,924,423 (GRCm39) missense probably damaging 1.00
IGL03375:Nup214 APN 2 31,900,233 (GRCm39) missense probably damaging 0.97
Des_moines UTSW 2 31,870,596 (GRCm39) splice site probably null
ANU74:Nup214 UTSW 2 31,924,978 (GRCm39) missense probably damaging 0.99
R0035:Nup214 UTSW 2 31,880,379 (GRCm39) splice site probably null
R0243:Nup214 UTSW 2 31,888,069 (GRCm39) splice site probably benign
R0270:Nup214 UTSW 2 31,924,826 (GRCm39) missense probably damaging 0.96
R0358:Nup214 UTSW 2 31,894,312 (GRCm39) splice site probably null
R1168:Nup214 UTSW 2 31,915,313 (GRCm39) missense probably benign
R1242:Nup214 UTSW 2 31,867,782 (GRCm39) missense probably benign 0.00
R1481:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1482:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1579:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1580:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1610:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1894:Nup214 UTSW 2 31,886,392 (GRCm39) missense possibly damaging 0.66
R2146:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2149:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2293:Nup214 UTSW 2 31,916,887 (GRCm39) missense probably benign
R2924:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R2925:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R3037:Nup214 UTSW 2 31,866,632 (GRCm39) missense probably benign 0.00
R3426:Nup214 UTSW 2 31,923,415 (GRCm39) missense probably damaging 0.97
R3799:Nup214 UTSW 2 31,924,694 (GRCm39) missense probably damaging 1.00
R3843:Nup214 UTSW 2 31,941,112 (GRCm39) missense probably damaging 1.00
R4323:Nup214 UTSW 2 31,884,696 (GRCm39) missense probably benign
R4353:Nup214 UTSW 2 31,867,929 (GRCm39) critical splice donor site probably null
R4601:Nup214 UTSW 2 31,887,977 (GRCm39) missense probably benign 0.36
R4626:Nup214 UTSW 2 31,923,416 (GRCm39) missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31,870,596 (GRCm39) splice site probably null
R4938:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R4939:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R5027:Nup214 UTSW 2 31,881,329 (GRCm39) missense probably damaging 1.00
R5358:Nup214 UTSW 2 31,907,158 (GRCm39) missense unknown
R5406:Nup214 UTSW 2 31,892,619 (GRCm39) missense probably damaging 0.96
R5507:Nup214 UTSW 2 31,878,188 (GRCm39) missense possibly damaging 0.87
R5695:Nup214 UTSW 2 31,924,385 (GRCm39) missense probably damaging 1.00
R5744:Nup214 UTSW 2 31,900,308 (GRCm39) missense probably damaging 0.97
R5908:Nup214 UTSW 2 31,881,353 (GRCm39) missense probably benign 0.03
R5967:Nup214 UTSW 2 31,869,790 (GRCm39) missense possibly damaging 0.52
R6140:Nup214 UTSW 2 31,941,808 (GRCm39) missense possibly damaging 0.92
R6243:Nup214 UTSW 2 31,892,944 (GRCm39) missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31,881,384 (GRCm39) missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31,872,683 (GRCm39) nonsense probably null
R6970:Nup214 UTSW 2 31,941,810 (GRCm39) missense probably damaging 1.00
R7028:Nup214 UTSW 2 31,924,168 (GRCm39) missense probably benign 0.22
R7114:Nup214 UTSW 2 31,915,256 (GRCm39) missense possibly damaging 0.83
R7120:Nup214 UTSW 2 31,941,054 (GRCm39) missense probably benign 0.07
R7249:Nup214 UTSW 2 31,878,245 (GRCm39) missense possibly damaging 0.92
R7821:Nup214 UTSW 2 31,916,917 (GRCm39) missense possibly damaging 0.83
R8026:Nup214 UTSW 2 31,923,362 (GRCm39) missense possibly damaging 0.55
R8264:Nup214 UTSW 2 31,884,738 (GRCm39) missense possibly damaging 0.79
R8284:Nup214 UTSW 2 31,886,458 (GRCm39) missense possibly damaging 0.83
R8356:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8397:Nup214 UTSW 2 31,880,266 (GRCm39) missense probably damaging 0.96
R8456:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8785:Nup214 UTSW 2 31,924,465 (GRCm39) missense probably damaging 0.97
R9257:Nup214 UTSW 2 31,923,347 (GRCm39) missense possibly damaging 0.92
R9291:Nup214 UTSW 2 31,867,806 (GRCm39) missense probably benign 0.00
R9376:Nup214 UTSW 2 31,924,244 (GRCm39) missense probably benign 0.00
R9408:Nup214 UTSW 2 31,937,523 (GRCm39) missense probably damaging 1.00
R9613:Nup214 UTSW 2 31,901,035 (GRCm39) missense possibly damaging 0.90
R9789:Nup214 UTSW 2 31,907,227 (GRCm39) missense possibly damaging 0.46
RF015:Nup214 UTSW 2 31,924,718 (GRCm39) missense probably benign 0.00
X0026:Nup214 UTSW 2 31,910,318 (GRCm39) missense possibly damaging 0.46
X0065:Nup214 UTSW 2 31,932,488 (GRCm39) missense probably damaging 1.00
Z1088:Nup214 UTSW 2 31,901,235 (GRCm39) missense probably benign 0.27
Z1176:Nup214 UTSW 2 31,924,237 (GRCm39) nonsense probably null
Z1176:Nup214 UTSW 2 31,900,270 (GRCm39) missense possibly damaging 0.66
Z1177:Nup214 UTSW 2 31,887,971 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCATCTCTGCAAACTTCTGACCCTG -3'
(R):5'- AATGCTGTCTGTCCGAACACTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTTCTTGTGCAGAC -3'
(R):5'- CTCCAGGAGCTGAAGCAC -3'
Posted On 2014-04-13