Incidental Mutation 'R1581:Fcrl1'
ID171381
Institutional Source Beutler Lab
Gene Symbol Fcrl1
Ensembl Gene ENSMUSG00000059994
Gene NameFc receptor-like 1
SynonymsFcrh1, BXMAS1-like, IFGP1, moFcRH1L, moFcRH1S, A230020G22Rik, mBXMH1, moFcRH1, mIFGP1
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87376387-87402934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87385723 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 249 (C249Y)
Ref Sequence ENSEMBL: ENSMUSP00000130936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072480] [ENSMUST00000163661] [ENSMUST00000194786] [ENSMUST00000191666] [ENSMUST00000167200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072480
AA Change: C229Y

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072300
Gene: ENSMUSG00000059994
AA Change: C229Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163661
AA Change: C249Y

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130936
Gene: ENSMUSG00000059994
AA Change: C249Y

DomainStartEndE-ValueType
IG 48 133 4.03e-8 SMART
IG 143 224 1.35e0 SMART
transmembrane domain 241 263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194786
AA Change: C229Y

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142286
Gene: ENSMUSG00000059994
AA Change: C229Y

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193854
Predicted Effect probably benign
Transcript: ENSMUST00000191666
SMART Domains Protein: ENSMUSP00000141916
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167200
SMART Domains Protein: ENSMUSP00000128235
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Fcrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Fcrl1 APN 3 87389635 missense probably damaging 0.99
IGL01884:Fcrl1 APN 3 87384737 missense probably damaging 1.00
IGL02029:Fcrl1 APN 3 87376487 utr 5 prime probably benign
IGL02231:Fcrl1 APN 3 87385162 missense possibly damaging 0.94
IGL02231:Fcrl1 APN 3 87385163 missense probably damaging 1.00
IGL02405:Fcrl1 APN 3 87385767 missense probably damaging 0.99
IGL02858:Fcrl1 APN 3 87384705 missense probably damaging 1.00
IGL03133:Fcrl1 APN 3 87389392 missense probably benign 0.00
IGL03176:Fcrl1 APN 3 87391257 missense probably damaging 1.00
IGL03352:Fcrl1 APN 3 87385091 missense probably benign 0.01
R1497:Fcrl1 UTSW 3 87384802 missense probably damaging 1.00
R1569:Fcrl1 UTSW 3 87384705 missense probably damaging 1.00
R1778:Fcrl1 UTSW 3 87385319 splice site probably benign
R1959:Fcrl1 UTSW 3 87376520 missense possibly damaging 0.92
R2928:Fcrl1 UTSW 3 87391257 missense probably benign 0.19
R4677:Fcrl1 UTSW 3 87390256 missense possibly damaging 0.61
R5122:Fcrl1 UTSW 3 87385774 missense probably benign 0.35
R5507:Fcrl1 UTSW 3 87391242 missense probably benign 0.16
R6363:Fcrl1 UTSW 3 87385168 missense probably damaging 0.96
R6478:Fcrl1 UTSW 3 87389639 missense probably benign 0.41
R6559:Fcrl1 UTSW 3 87391253 missense probably benign 0.33
R6985:Fcrl1 UTSW 3 87389650 missense probably benign
R7291:Fcrl1 UTSW 3 87385781 critical splice donor site probably null
Z1177:Fcrl1 UTSW 3 87389363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCCTTGAACATAATTGACACCG -3'
(R):5'- TTGGGTAAGACTGCTGCACTGATG -3'

Sequencing Primer
(F):5'- CTTGAACATAATTGACACCGGAGATG -3'
(R):5'- CCTAAAATGGTGCTTTTACAGGCTG -3'
Posted On2014-04-13