Mutagenetix > Incidental Mutations

Incidental Mutation 'R1581:Padi6'

171387

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

039618-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140735836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 146 (Y146C)

Ref Sequence

ENSEMBL: ENSMUSP00000123490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably damaging
Transcript: ENSMUST00000038749
AA Change: Y221C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: Y221C

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Predicted Effect

probably damaging
Transcript: ENSMUST00000130267
AA Change: Y146C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935
AA Change: Y146C

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	C	15: 91,179,144	E447G	probably benign	Het
Actn4	T	C	7: 28,898,646	T510A	probably benign	Het
Adgrb3	A	G	1: 25,094,072	M1311T	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bicdl1	G	T	5: 115,651,267		probably benign	Het
Bmyc	T	C	2: 25,707,334	S137P	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Casc3	C	T	11: 98,822,818	T292I	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cnnm2	A	G	19: 46,763,123	T451A	probably damaging	Het
Eed	T	C	7: 89,980,468	K20E	possibly damaging	Het
Eps15	T	A	4: 109,363,186	M180K	probably benign	Het
Esr1	T	C	10: 4,997,905	I486T	probably damaging	Het
Etnppl	A	G	3: 130,628,744	I207V	possibly damaging	Het
Fam92a	T	A	4: 12,155,745		probably null	Het
Fancg	G	A	4: 43,007,039	P246L	probably damaging	Het
Fcrl1	G	A	3: 87,385,723	C249Y	possibly damaging	Het
Foxred2	A	G	15: 77,955,761	F110L	possibly damaging	Het
Fsip2	A	T	2: 82,986,282	N4120Y	probably damaging	Het
Gm156	T	C	6: 129,775,833	D3G	probably benign	Het
Gm4884	C	T	7: 41,043,831	S408L	probably benign	Het
Gm9476	T	C	10: 100,306,612		noncoding transcript	Het
Gria1	T	C	11: 57,237,010		probably null	Het
H6pd	T	A	4: 149,982,514	I472F	possibly damaging	Het
Hydin	A	T	8: 110,410,460	M632L	probably benign	Het
Hyou1	C	T	9: 44,388,870	P819S	probably damaging	Het
Il6st	A	G	13: 112,481,541	E163G	probably damaging	Het
Kcnk1	T	C	8: 125,995,539	V27A	possibly damaging	Het
Kdelr3	T	C	15: 79,522,913		probably null	Het
Klk1b22	A	G	7: 44,115,975	N117S	possibly damaging	Het
Lpp	C	A	16: 24,681,841	C134*	probably null	Het
Lrrc37a	G	A	11: 103,457,017	R2951*	probably null	Het
Luzp2	T	A	7: 55,249,490	D285E	possibly damaging	Het
Ly75	C	T	2: 60,327,893	R1016H	probably damaging	Het
Mesp2	T	A	7: 79,812,541	S282T	possibly damaging	Het
Nav3	T	C	10: 109,823,428	D776G	probably damaging	Het
Nr2e1	T	C	10: 42,567,968	T253A	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr398	A	T	11: 73,984,521	L29H	probably damaging	Het
Pank4	C	T	4: 154,974,651	R414W	probably damaging	Het
Pclo	T	G	5: 14,521,282	I227S	probably benign	Het
Plppr4	A	G	3: 117,328,266	V221A	possibly damaging	Het
Pradc1	G	A	6: 85,448,586	R25C	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rnd2	A	G	11: 101,471,196	T192A	probably benign	Het
Rtbdn	A	G	8: 84,955,066	E131G	probably benign	Het
Ryr2	A	G	13: 11,794,563	V792A	probably benign	Het
Sacs	G	T	14: 61,213,679	Q4391H	probably damaging	Het
Scd2	A	G	19: 44,298,099	S123G	probably benign	Het
Sept9	A	G	11: 117,290,595	R74G	probably damaging	Het
Sipa1l2	T	A	8: 125,491,617	Q327L	probably damaging	Het
Skor1	T	C	9: 63,146,223	T127A	probably damaging	Het
Sphk2	A	G	7: 45,713,496	V57A	probably damaging	Het
Tfec	A	T	6: 16,844,244	D101E	probably damaging	Het
Tmem43	T	A	6: 91,478,735	H109Q	probably benign	Het
Tmem67	C	A	4: 12,047,814	S839I	probably damaging	Het
Trpv5	T	C	6: 41,653,140	Y672C	probably damaging	Het
Ttc39d	A	C	17: 80,216,484	S191R	probably benign	Het
Ttll1	C	T	15: 83,496,277	V296M	probably damaging	Het
Upp2	A	C	2: 58,774,165	K130T	possibly damaging	Het
Vmn2r5	A	G	3: 64,491,219	C780R	probably damaging	Het
Wars	C	A	12: 108,875,709	E171*	probably null	Het
Zeb2	A	T	2: 44,997,000	S637T	probably damaging	Het
Zfp27	T	A	7: 29,896,124	T139S	possibly damaging	Het
Zfp941	A	T	7: 140,812,120	L442Q	probably benign	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGACCTGGCTCCATTGGTCAC -3'
(R):5'- TGGGACGGCGATATCAATCACAAAG -3'

Sequencing Primer
(F):5'- CTGTACCGAGAGCTTCAGTGTC -3'
(R):5'- AGCTTCACACCTGGTCAC -3'

Posted On

2014-04-13