Incidental Mutation 'R1581:Pank4'
List |< first << previous [record 42 of 67] next >> last >|
ID171389
Institutional Source Beutler Lab
Gene Symbol Pank4
Ensembl Gene ENSMUSG00000029056
Gene Namepantothenate kinase 4
SynonymsD030031I12Rik
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154964123-154980938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154974651 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 414 (R414W)
Ref Sequence ENSEMBL: ENSMUSP00000064330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953]
Predicted Effect probably damaging
Transcript: ENSMUST00000030931
AA Change: R414W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056
AA Change: R414W

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070953
AA Change: R414W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056
AA Change: R414W

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148299
Predicted Effect unknown
Transcript: ENSMUST00000148934
AA Change: R271W
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056
AA Change: R271W

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Pank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Pank4 APN 4 154980602 missense possibly damaging 0.50
IGL01105:Pank4 APN 4 154972465 splice site probably benign
IGL01291:Pank4 APN 4 154974646 missense probably damaging 0.98
IGL01935:Pank4 APN 4 154979530 missense probably damaging 1.00
IGL02366:Pank4 APN 4 154969628 missense probably benign 0.03
IGL02514:Pank4 APN 4 154970465 missense probably damaging 0.99
IGL03028:Pank4 APN 4 154969985 unclassified probably benign
IGL03033:Pank4 APN 4 154974715 missense probably damaging 1.00
ANU05:Pank4 UTSW 4 154974646 missense probably damaging 0.98
R0518:Pank4 UTSW 4 154976625 missense possibly damaging 0.90
R1196:Pank4 UTSW 4 154978173 missense probably damaging 0.99
R1566:Pank4 UTSW 4 154980521 missense probably damaging 0.98
R1709:Pank4 UTSW 4 154970047 missense probably damaging 1.00
R1852:Pank4 UTSW 4 154976359 missense probably damaging 1.00
R1950:Pank4 UTSW 4 154972520 missense probably benign
R2943:Pank4 UTSW 4 154971474 missense probably benign 0.01
R3911:Pank4 UTSW 4 154969601 missense probably damaging 1.00
R4162:Pank4 UTSW 4 154979594 critical splice donor site probably null
R4404:Pank4 UTSW 4 154980156 missense probably benign 0.00
R4619:Pank4 UTSW 4 154976619 missense probably benign 0.07
R4731:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4732:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4733:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4747:Pank4 UTSW 4 154979532 missense probably damaging 1.00
R4760:Pank4 UTSW 4 154974634 missense possibly damaging 0.60
R5218:Pank4 UTSW 4 154979728 missense probably benign 0.01
R5278:Pank4 UTSW 4 154972165 missense probably damaging 1.00
R5774:Pank4 UTSW 4 154980662 missense probably damaging 1.00
R6004:Pank4 UTSW 4 154977221 missense probably damaging 1.00
R6376:Pank4 UTSW 4 154972236 splice site probably null
R7105:Pank4 UTSW 4 154980167 missense probably benign 0.07
R7253:Pank4 UTSW 4 154970920 missense probably benign 0.02
R7481:Pank4 UTSW 4 154970038 missense probably damaging 1.00
R7565:Pank4 UTSW 4 154980550 missense probably benign 0.08
R7718:Pank4 UTSW 4 154974643 missense probably damaging 1.00
R7736:Pank4 UTSW 4 154969747 missense probably benign 0.03
R8144:Pank4 UTSW 4 154970080 missense probably benign 0.01
Z1177:Pank4 UTSW 4 154974745 missense probably damaging 1.00
Z1177:Pank4 UTSW 4 154974784 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACTGTTGAGAACCAGAGCTGGAAC -3'
(R):5'- TTGCTGTGTCTTGGAGCCTCAC -3'

Sequencing Primer
(F):5'- TTAGGGAGCTACCCTGATCTGAAG -3'
(R):5'- TGGAGCCTCACCCCATC -3'
Posted On2014-04-13