Incidental Mutation 'R1581:Trpv5'
List |< first << previous [record 59 of 67] next >> last >|
ID171393
Institutional Source Beutler Lab
Gene Symbol Trpv5
Ensembl Gene ENSMUSG00000036899
Gene Nametransient receptor potential cation channel, subfamily V, member 5
SynonymsECaC1, CaT2
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41652173-41680769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41653140 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 672 (Y672C)
Ref Sequence ENSEMBL: ENSMUSP00000141421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]
Predicted Effect probably damaging
Transcript: ENSMUST00000031901
AA Change: Y721C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899
AA Change: Y721C

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193503
AA Change: Y672C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899
AA Change: Y672C

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Trpv5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Trpv5 APN 6 41675375 missense possibly damaging 0.87
IGL01704:Trpv5 APN 6 41653258 missense possibly damaging 0.88
IGL01860:Trpv5 APN 6 41660295 missense probably damaging 1.00
IGL01950:Trpv5 APN 6 41675978 missense probably benign 0.09
Firesign UTSW 6 41658042 missense probably damaging 1.00
gingame UTSW 6 41670961 missense probably damaging 1.00
R0515:Trpv5 UTSW 6 41674211 intron probably benign
R1633:Trpv5 UTSW 6 41675920 nonsense probably null
R1658:Trpv5 UTSW 6 41674282 missense probably damaging 1.00
R1677:Trpv5 UTSW 6 41657797 missense probably benign 0.44
R1955:Trpv5 UTSW 6 41657937 missense probably damaging 1.00
R2008:Trpv5 UTSW 6 41659728 critical splice acceptor site probably null
R2331:Trpv5 UTSW 6 41659968 missense probably damaging 1.00
R2519:Trpv5 UTSW 6 41674350 missense probably damaging 0.99
R2973:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R2974:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R3877:Trpv5 UTSW 6 41660343 missense probably benign 0.10
R3923:Trpv5 UTSW 6 41653249 missense probably benign 0.00
R4056:Trpv5 UTSW 6 41659705 missense probably damaging 1.00
R4396:Trpv5 UTSW 6 41657896 missense probably benign 0.00
R4757:Trpv5 UTSW 6 41653214 missense probably damaging 0.98
R5013:Trpv5 UTSW 6 41659713 missense probably damaging 1.00
R5039:Trpv5 UTSW 6 41675945 missense possibly damaging 0.73
R5330:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R5331:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R6270:Trpv5 UTSW 6 41674359 missense possibly damaging 0.94
R6405:Trpv5 UTSW 6 41674668 missense probably damaging 1.00
R6575:Trpv5 UTSW 6 41675969 missense probably benign
R6669:Trpv5 UTSW 6 41658042 missense probably damaging 1.00
R6681:Trpv5 UTSW 6 41653354 missense probably damaging 0.97
R6817:Trpv5 UTSW 6 41658007 missense possibly damaging 0.65
R7021:Trpv5 UTSW 6 41653270 missense probably benign 0.00
R7069:Trpv5 UTSW 6 41675960 missense possibly damaging 0.94
R7161:Trpv5 UTSW 6 41660536 nonsense probably null
R7241:Trpv5 UTSW 6 41675308 nonsense probably null
R7505:Trpv5 UTSW 6 41674656 missense probably damaging 0.99
R7806:Trpv5 UTSW 6 41674933 missense probably damaging 0.99
R8060:Trpv5 UTSW 6 41674531 nonsense probably null
R8407:Trpv5 UTSW 6 41675338 missense probably benign 0.02
R8428:Trpv5 UTSW 6 41653248 missense possibly damaging 0.48
R8435:Trpv5 UTSW 6 41670893 missense probably damaging 1.00
R8762:Trpv5 UTSW 6 41675379 missense probably benign 0.36
Z1177:Trpv5 UTSW 6 41674321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTGATGACCATTGCCCATCTC -3'
(R):5'- TTTCCTCCCAGGGTTGAACACCAC -3'

Sequencing Primer
(F):5'- CCATCTCTACAAATGCTCAAATGTG -3'
(R):5'- AACCTTCTGGGACTGAGACTG -3'
Posted On2014-04-13