Incidental Mutation 'R1581:Mesp2'
ID 171404
Institutional Source Beutler Lab
Gene Symbol Mesp2
Ensembl Gene ENSMUSG00000030543
Gene Name mesoderm posterior 2
Synonyms bHLHc6
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1581 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79810727-79813439 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79812541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 282 (S282T)
Ref Sequence ENSEMBL: ENSMUSP00000103017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107394]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000107394
AA Change: S282T

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103017
Gene: ENSMUSG00000030543
AA Change: S282T

low complexity region 25 45 N/A INTRINSIC
low complexity region 57 77 N/A INTRINSIC
HLH 85 139 2.16e-10 SMART
internal_repeat_1 161 203 8.79e-6 PROSPERO
internal_repeat_1 219 255 8.79e-6 PROSPERO
low complexity region 282 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of segmented somites, fused vertebral columns and dorsal root ganglia, and impaired sclerotomal polarity. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Mesp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mesp2 APN 7 79812653 missense probably benign
IGL02672:Mesp2 APN 7 79811397 missense probably benign 0.01
IGL02707:Mesp2 APN 7 79811526 missense probably benign 0.29
R1614:Mesp2 UTSW 7 79811619 missense probably benign 0.00
R3716:Mesp2 UTSW 7 79812794 missense possibly damaging 0.96
R5131:Mesp2 UTSW 7 79811727 missense possibly damaging 0.83
R5221:Mesp2 UTSW 7 79811719 missense possibly damaging 0.84
R5551:Mesp2 UTSW 7 79811619 missense probably benign 0.00
R7599:Mesp2 UTSW 7 79810969 missense probably damaging 0.98
R9480:Mesp2 UTSW 7 79811286 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gctaatacagcaccccattttac -3'
Posted On 2014-04-13