Incidental Mutation 'R1581:Zfp941'
ID171407
Institutional Source Beutler Lab
Gene Symbol Zfp941
Ensembl Gene ENSMUSG00000060314
Gene Namezinc finger protein 941
SynonymsBC066028
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140807449-140822178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140812120 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 442 (L442Q)
Ref Sequence ENSEMBL: ENSMUSP00000101667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080651] [ENSMUST00000106052] [ENSMUST00000150053]
Predicted Effect probably benign
Transcript: ENSMUST00000080651
AA Change: L442Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079482
Gene: ENSMUSG00000060314
AA Change: L442Q

DomainStartEndE-ValueType
KRAB 4 65 3.88e-21 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 1.12e-3 SMART
ZnF_C2H2 395 417 7.78e-3 SMART
ZnF_C2H2 423 445 1.12e-3 SMART
ZnF_C2H2 451 471 1.16e1 SMART
ZnF_C2H2 500 522 2.57e-3 SMART
ZnF_C2H2 528 550 7.9e-4 SMART
ZnF_C2H2 556 578 6.42e-4 SMART
ZnF_C2H2 584 606 1.38e-3 SMART
ZnF_C2H2 612 634 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106052
AA Change: L442Q

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101667
Gene: ENSMUSG00000060314
AA Change: L442Q

DomainStartEndE-ValueType
KRAB 4 65 3.88e-21 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 1.12e-3 SMART
ZnF_C2H2 395 417 7.78e-3 SMART
ZnF_C2H2 423 445 1.12e-3 SMART
ZnF_C2H2 451 471 1.16e1 SMART
ZnF_C2H2 500 522 2.57e-3 SMART
ZnF_C2H2 528 550 7.9e-4 SMART
ZnF_C2H2 556 578 6.42e-4 SMART
ZnF_C2H2 584 606 1.38e-3 SMART
ZnF_C2H2 612 634 3.69e-4 SMART
ZnF_C2H2 640 662 2.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150053
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Other mutations in Zfp941
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Zfp941 APN 7 140811928 missense probably damaging 1.00
IGL02399:Zfp941 APN 7 140812699 missense probably benign 0.37
IGL03202:Zfp941 APN 7 140813053 missense probably benign 0.02
R0025:Zfp941 UTSW 7 140813272 missense probably benign 0.01
R0025:Zfp941 UTSW 7 140813272 missense probably benign 0.01
R0226:Zfp941 UTSW 7 140813275 missense probably damaging 1.00
R0945:Zfp941 UTSW 7 140811664 missense probably damaging 0.99
R1455:Zfp941 UTSW 7 140812774 missense probably benign 0.29
R2474:Zfp941 UTSW 7 140811471 missense probably damaging 1.00
R4052:Zfp941 UTSW 7 140812427 missense possibly damaging 0.81
R4576:Zfp941 UTSW 7 140811590 nonsense probably null
R4604:Zfp941 UTSW 7 140812211 missense probably damaging 1.00
R5170:Zfp941 UTSW 7 140812957 unclassified probably benign
R5311:Zfp941 UTSW 7 140811959 nonsense probably null
R5505:Zfp941 UTSW 7 140811917 missense probably benign 0.03
R5549:Zfp941 UTSW 7 140808108 missense possibly damaging 0.46
R5566:Zfp941 UTSW 7 140812766 missense probably benign 0.01
R5723:Zfp941 UTSW 7 140812850 unclassified probably benign
R5736:Zfp941 UTSW 7 140813060 missense probably benign 0.01
R5861:Zfp941 UTSW 7 140812139 missense probably damaging 1.00
R6041:Zfp941 UTSW 7 140812245 nonsense probably null
R6058:Zfp941 UTSW 7 140812097 missense probably damaging 1.00
R6226:Zfp941 UTSW 7 140812485 missense probably benign 0.01
R6488:Zfp941 UTSW 7 140812750 missense probably benign 0.37
R6824:Zfp941 UTSW 7 140812699 missense probably benign 0.37
R7356:Zfp941 UTSW 7 140812115 missense possibly damaging 0.66
R7554:Zfp941 UTSW 7 140812057 missense possibly damaging 0.69
Z1177:Zfp941 UTSW 7 140812186 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTCGCTCCAGGACGAATGCTATG -3'
(R):5'- AACTTCAGCGGTGGTTCAGCTC -3'

Sequencing Primer
(F):5'- CTATGGCAACGTCTGCTGG -3'
(R):5'- caaatgtggagagtgtggtaaag -3'
Posted On2014-04-13