Incidental Mutation 'R1581:Camsap3'
ID 171408
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Name calmodulin regulated spectrin-associated protein family, member 3
Synonyms Nezha, 2310057J16Rik
MMRRC Submission 039618-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R1581 (G1)
Quality Score 85
Status Not validated
Chromosome 8
Chromosomal Location 3637293-3659075 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3654708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 782 (R782C)
Ref Sequence ENSEMBL: ENSMUSP00000146852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
AlphaFold Q80VC9
Predicted Effect probably damaging
Transcript: ENSMUST00000057028
AA Change: R766C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: R766C

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably damaging
Transcript: ENSMUST00000171962
AA Change: R767C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: R767C

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: R782C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably damaging
Transcript: ENSMUST00000207432
AA Change: R793C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably damaging
Transcript: ENSMUST00000207970
AA Change: R777C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Meta Mutation Damage Score 0.3178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,063,347 (GRCm39) E447G probably benign Het
Actn4 T C 7: 28,598,071 (GRCm39) T510A probably benign Het
Adgrb3 A G 1: 25,133,153 (GRCm39) M1311T possibly damaging Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bicdl1 G T 5: 115,789,326 (GRCm39) probably benign Het
Bmyc T C 2: 25,597,346 (GRCm39) S137P probably damaging Het
Casc3 C T 11: 98,713,644 (GRCm39) T292I possibly damaging Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Cibar1 T A 4: 12,155,745 (GRCm39) probably null Het
Cnnm2 A G 19: 46,751,562 (GRCm39) T451A probably damaging Het
Eed T C 7: 89,629,676 (GRCm39) K20E possibly damaging Het
Eps15 T A 4: 109,220,383 (GRCm39) M180K probably benign Het
Esr1 T C 10: 4,947,905 (GRCm39) I486T probably damaging Het
Etnppl A G 3: 130,422,393 (GRCm39) I207V possibly damaging Het
Fancg G A 4: 43,007,039 (GRCm39) P246L probably damaging Het
Fcrl1 G A 3: 87,293,030 (GRCm39) C249Y possibly damaging Het
Foxred2 A G 15: 77,839,961 (GRCm39) F110L possibly damaging Het
Fsip2 A T 2: 82,816,626 (GRCm39) N4120Y probably damaging Het
Gm4884 C T 7: 40,693,255 (GRCm39) S408L probably benign Het
Gm9476 T C 10: 100,142,474 (GRCm39) noncoding transcript Het
Gria1 T C 11: 57,127,836 (GRCm39) probably null Het
H6pd T A 4: 150,066,971 (GRCm39) I472F possibly damaging Het
Hydin A T 8: 111,137,092 (GRCm39) M632L probably benign Het
Hyou1 C T 9: 44,300,167 (GRCm39) P819S probably damaging Het
Il6st A G 13: 112,618,075 (GRCm39) E163G probably damaging Het
Kcnk1 T C 8: 126,722,278 (GRCm39) V27A possibly damaging Het
Kdelr3 T C 15: 79,407,114 (GRCm39) probably null Het
Klk1b22 A G 7: 43,765,399 (GRCm39) N117S possibly damaging Het
Klrh1 T C 6: 129,752,796 (GRCm39) D3G probably benign Het
Lpp C A 16: 24,500,591 (GRCm39) C134* probably null Het
Lrrc37a G A 11: 103,347,843 (GRCm39) R2951* probably null Het
Luzp2 T A 7: 54,899,238 (GRCm39) D285E possibly damaging Het
Ly75 C T 2: 60,158,237 (GRCm39) R1016H probably damaging Het
Mesp2 T A 7: 79,462,289 (GRCm39) S282T possibly damaging Het
Nav3 T C 10: 109,659,289 (GRCm39) D776G probably damaging Het
Nr2e1 T C 10: 42,443,964 (GRCm39) T253A probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or1r1 A T 11: 73,875,347 (GRCm39) L29H probably damaging Het
Padi6 T C 4: 140,463,147 (GRCm39) Y146C probably damaging Het
Pank4 C T 4: 155,059,108 (GRCm39) R414W probably damaging Het
Pclo T G 5: 14,571,296 (GRCm39) I227S probably benign Het
Plppr4 A G 3: 117,121,915 (GRCm39) V221A possibly damaging Het
Pradc1 G A 6: 85,425,568 (GRCm39) R25C probably damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rnd2 A G 11: 101,362,022 (GRCm39) T192A probably benign Het
Rtbdn A G 8: 85,681,695 (GRCm39) E131G probably benign Het
Ryr2 A G 13: 11,809,449 (GRCm39) V792A probably benign Het
Sacs G T 14: 61,451,128 (GRCm39) Q4391H probably damaging Het
Scd2 A G 19: 44,286,538 (GRCm39) S123G probably benign Het
Septin9 A G 11: 117,181,421 (GRCm39) R74G probably damaging Het
Sipa1l2 T A 8: 126,218,356 (GRCm39) Q327L probably damaging Het
Skor1 T C 9: 63,053,505 (GRCm39) T127A probably damaging Het
Sphk2 A G 7: 45,362,920 (GRCm39) V57A probably damaging Het
Tfec A T 6: 16,844,243 (GRCm39) D101E probably damaging Het
Tmem43 T A 6: 91,455,717 (GRCm39) H109Q probably benign Het
Tmem67 C A 4: 12,047,814 (GRCm39) S839I probably damaging Het
Trpv5 T C 6: 41,630,074 (GRCm39) Y672C probably damaging Het
Ttc39d A C 17: 80,523,913 (GRCm39) S191R probably benign Het
Ttll1 C T 15: 83,380,478 (GRCm39) V296M probably damaging Het
Upp2 A C 2: 58,664,177 (GRCm39) K130T possibly damaging Het
Vmn2r5 A G 3: 64,398,640 (GRCm39) C780R probably damaging Het
Wars1 C A 12: 108,841,635 (GRCm39) E171* probably null Het
Zeb2 A T 2: 44,887,012 (GRCm39) S637T probably damaging Het
Zfp27 T A 7: 29,595,549 (GRCm39) T139S possibly damaging Het
Zfp941 A T 7: 140,392,033 (GRCm39) L442Q probably benign Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3,652,077 (GRCm39) missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3,652,115 (GRCm39) splice site probably benign
IGL01457:Camsap3 APN 8 3,654,795 (GRCm39) missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3,658,508 (GRCm39) missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3,653,845 (GRCm39) missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3,653,913 (GRCm39) missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3,654,288 (GRCm39) missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0347:Camsap3 UTSW 8 3,652,029 (GRCm39) missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R0946:Camsap3 UTSW 8 3,654,442 (GRCm39) missense probably benign 0.00
R1169:Camsap3 UTSW 8 3,653,866 (GRCm39) missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3,653,968 (GRCm39) missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R1820:Camsap3 UTSW 8 3,653,485 (GRCm39) missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3,653,922 (GRCm39) nonsense probably null
R1914:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3,654,789 (GRCm39) missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3,656,808 (GRCm39) missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3,656,515 (GRCm39) missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3,650,689 (GRCm39) missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3,654,244 (GRCm39) missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3,650,680 (GRCm39) missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3,653,812 (GRCm39) missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3,654,276 (GRCm39) missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3,647,899 (GRCm39) missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3,653,980 (GRCm39) missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3,651,999 (GRCm39) missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3,651,971 (GRCm39) missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3,653,941 (GRCm39) missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3,658,742 (GRCm39) missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3,654,186 (GRCm39) missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3,658,242 (GRCm39) missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3,657,834 (GRCm39) unclassified probably benign
R7109:Camsap3 UTSW 8 3,648,087 (GRCm39) missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3,650,371 (GRCm39) missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3,654,116 (GRCm39) missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3,654,648 (GRCm39) missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R7512:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R7779:Camsap3 UTSW 8 3,647,887 (GRCm39) missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3,648,075 (GRCm39) missense probably benign 0.00
R8356:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8456:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8696:Camsap3 UTSW 8 3,653,614 (GRCm39) missense probably damaging 1.00
R8804:Camsap3 UTSW 8 3,652,624 (GRCm39) missense probably benign 0.14
R9022:Camsap3 UTSW 8 3,656,575 (GRCm39) missense probably benign 0.08
R9380:Camsap3 UTSW 8 3,653,999 (GRCm39) missense probably benign 0.09
R9706:Camsap3 UTSW 8 3,658,689 (GRCm39) missense possibly damaging 0.92
Z1192:Camsap3 UTSW 8 3,654,124 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCACAAGTCAGTTACCTTCTCTC -3'
(R):5'- ATCTCCTTCCTCATCAGCAGCAGG -3'

Sequencing Primer
(F):5'- CAGTCAGTAAGCTGAGTGCC -3'
(R):5'- CCCTCCGACAGGAGGATAGAG -3'
Posted On 2014-04-13