Incidental Mutation 'R1581:Rtbdn'
List |< first << previous [record 48 of 67] next >> last >|
ID171409
Institutional Source Beutler Lab
Gene Symbol Rtbdn
Ensembl Gene ENSMUSG00000048617
Gene Nameretbindin
Synonyms
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84946991-84956603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84955066 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000132841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065049] [ENSMUST00000067472] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000109740] [ENSMUST00000121880] [ENSMUST00000128972] [ENSMUST00000147812] [ENSMUST00000152378]
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067472
AA Change: E162G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070558
Gene: ENSMUSG00000048617
AA Change: E162G

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 2e-40 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109740
AA Change: E162G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105362
Gene: ENSMUSG00000048617
AA Change: E162G

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121880
AA Change: E162G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113982
Gene: ENSMUSG00000048617
AA Change: E162G

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126029
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152378
AA Change: E131G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132841
Gene: ENSMUSG00000048617
AA Change: E131G

DomainStartEndE-ValueType
Pfam:Folate_rec 2 172 2.8e-38 PFAM
low complexity region 193 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Rtbdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rtbdn APN 8 84955089 missense probably damaging 1.00
IGL03192:Rtbdn APN 8 84952655 missense probably benign 0.32
FR4342:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4342:Rtbdn UTSW 8 84956178 small insertion probably benign
FR4589:Rtbdn UTSW 8 84956171 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956161 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956176 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956177 small insertion probably benign
R5057:Rtbdn UTSW 8 84955009 missense probably damaging 1.00
R6788:Rtbdn UTSW 8 84952674 missense probably null 1.00
R7570:Rtbdn UTSW 8 84952927 missense probably damaging 1.00
RF023:Rtbdn UTSW 8 84956166 small insertion probably benign
RF024:Rtbdn UTSW 8 84956179 small insertion probably benign
RF025:Rtbdn UTSW 8 84956175 small insertion probably benign
RF034:Rtbdn UTSW 8 84956175 small insertion probably benign
RF046:Rtbdn UTSW 8 84956179 small insertion probably benign
RF050:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956172 small insertion probably benign
RF057:Rtbdn UTSW 8 84956166 small insertion probably benign
RF058:Rtbdn UTSW 8 84956172 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAACTCTGGGTGTCTGAGGGA -3'
(R):5'- CTGGGGAGACAGTGCTAGACGATT -3'

Sequencing Primer
(F):5'- AGGGATTGGGGCCTGAG -3'
(R):5'- tgggaggcagaggcaag -3'
Posted On2014-04-13