Incidental Mutation 'R1581:Hyou1'
ID171414
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Namehypoxia up-regulated 1
SynonymsGrp170, Cab140, Orp150, 140 kDa, CBP-140
MMRRC Submission 039618-MU
Accession Numbers

Genbank: NM_021395; MGI: 108030

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44379490-44392369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44388870 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 819 (P819S)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560]
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: P819S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: P819S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: P819S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: P819S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: P819S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: P819S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44385146 missense probably benign 0.02
IGL01660:Hyou1 APN 9 44381117 missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44382012 missense probably benign 0.21
IGL01903:Hyou1 APN 9 44381141 splice site probably benign
IGL02636:Hyou1 APN 9 44381410 critical splice donor site probably null
IGL02806:Hyou1 APN 9 44388883 nonsense probably null
IGL03401:Hyou1 APN 9 44384909 missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44388058 missense probably benign
ANU74:Hyou1 UTSW 9 44381263 missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44384477 missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44390851 missense probably benign 0.26
R0408:Hyou1 UTSW 9 44384692 missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44389242 missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44384681 missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44389406 missense probably benign 0.02
R1803:Hyou1 UTSW 9 44384182 nonsense probably null
R2060:Hyou1 UTSW 9 44381552 missense probably benign 0.28
R2180:Hyou1 UTSW 9 44388019 missense probably benign 0.30
R2233:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R2235:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R3950:Hyou1 UTSW 9 44385227 missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44380615 splice site probably null
R4393:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44387121 intron probably benign
R5239:Hyou1 UTSW 9 44385263 missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44385249 missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44388926 critical splice donor site probably null
R5856:Hyou1 UTSW 9 44381344 missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44382025 critical splice donor site probably null
R6594:Hyou1 UTSW 9 44389322 missense probably benign
R6596:Hyou1 UTSW 9 44387755 missense probably benign 0.00
R6613:Hyou1 UTSW 9 44382498 missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44381134 critical splice donor site probably null
R6849:Hyou1 UTSW 9 44387264 missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44389409 missense probably benign 0.04
R7632:Hyou1 UTSW 9 44381136 splice site probably null
R7711:Hyou1 UTSW 9 44384462 missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44385585 missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44388133 missense probably benign 0.26
X0027:Hyou1 UTSW 9 44390856 missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44387742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGCTGTACCAGCCTGAGTACC -3'
(R):5'- CGTCATCTCCACTTCAGTGAAGACC -3'

Sequencing Primer
(F):5'- ATTTGGAGCCACCACTGTG -3'
(R):5'- AGTGAAGACCTGGTCCATCTC -3'
Posted On2014-04-13