Incidental Mutation 'R1581:Skor1'
ID171415
Institutional Source Beutler Lab
Gene Symbol Skor1
Ensembl Gene ENSMUSG00000022245
Gene NameSKI family transcriptional corepressor 1
SynonymsCorl1, C230094B15Rik, Lbxcor1
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R1581 (G1)
Quality Score215
Status Not validated
Chromosome9
Chromosomal Location63138170-63148961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63146223 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 127 (T127A)
Ref Sequence ENSEMBL: ENSMUSP00000113924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055281] [ENSMUST00000116613] [ENSMUST00000119146]
Predicted Effect probably damaging
Transcript: ENSMUST00000055281
AA Change: T155A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055037
Gene: ENSMUSG00000022245
AA Change: T155A

DomainStartEndE-ValueType
Pfam:Ski_Sno 61 168 3.2e-41 PFAM
c-SKI_SMAD_bind 180 272 2.48e-56 SMART
low complexity region 284 312 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
low complexity region 345 366 N/A INTRINSIC
low complexity region 379 398 N/A INTRINSIC
low complexity region 414 454 N/A INTRINSIC
low complexity region 465 479 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 568 582 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
SCOP:d1eq1a_ 850 937 1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116613
AA Change: T116A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112312
Gene: ENSMUSG00000022245
AA Change: T116A

DomainStartEndE-ValueType
Pfam:Ski_Sno 17 130 3.5e-42 PFAM
c-SKI_SMAD_bind 141 233 2.48e-56 SMART
low complexity region 245 273 N/A INTRINSIC
low complexity region 294 303 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
low complexity region 375 415 N/A INTRINSIC
low complexity region 426 440 N/A INTRINSIC
low complexity region 463 486 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
SCOP:d1eq1a_ 811 898 1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119146
AA Change: T127A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113924
Gene: ENSMUSG00000022245
AA Change: T127A

DomainStartEndE-ValueType
Pfam:Ski_Sno 28 141 3e-42 PFAM
c-SKI_SMAD_bind 152 244 2.48e-56 SMART
low complexity region 256 284 N/A INTRINSIC
low complexity region 305 314 N/A INTRINSIC
low complexity region 317 338 N/A INTRINSIC
low complexity region 351 370 N/A INTRINSIC
low complexity region 386 426 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
low complexity region 474 497 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
SCOP:d1eq1a_ 822 909 1e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Skor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Skor1 APN 9 63146441 missense probably damaging 1.00
IGL00736:Skor1 APN 9 63139538 missense probably damaging 0.99
IGL01344:Skor1 APN 9 63142278 missense possibly damaging 0.79
IGL01383:Skor1 APN 9 63146556 missense probably benign 0.12
IGL01456:Skor1 APN 9 63145490 missense probably damaging 1.00
IGL02503:Skor1 APN 9 63146115 missense probably damaging 1.00
IGL02526:Skor1 APN 9 63145877 missense probably damaging 1.00
IGL02699:Skor1 APN 9 63140046 splice site probably benign
R0041:Skor1 UTSW 9 63145851 missense probably damaging 1.00
R0092:Skor1 UTSW 9 63145995 missense probably damaging 1.00
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1598:Skor1 UTSW 9 63146004 missense probably damaging 1.00
R2172:Skor1 UTSW 9 63145122 missense possibly damaging 0.84
R3734:Skor1 UTSW 9 63140068 missense probably damaging 1.00
R3803:Skor1 UTSW 9 63145586 missense probably benign 0.06
R3839:Skor1 UTSW 9 63144448 missense probably damaging 0.97
R4627:Skor1 UTSW 9 63145476 missense probably damaging 1.00
R4698:Skor1 UTSW 9 63144548 missense probably benign
R4712:Skor1 UTSW 9 63139573 splice site probably null
R4781:Skor1 UTSW 9 63144459 missense probably benign
R5089:Skor1 UTSW 9 63145923 missense probably damaging 0.99
R5735:Skor1 UTSW 9 63146064 missense probably damaging 1.00
R6279:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6300:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6396:Skor1 UTSW 9 63144950 missense probably damaging 1.00
R6791:Skor1 UTSW 9 63140354 splice site probably null
R7371:Skor1 UTSW 9 63146887 splice site probably null
R7448:Skor1 UTSW 9 63146103 missense probably damaging 1.00
R7491:Skor1 UTSW 9 63146448 missense probably damaging 0.99
R7496:Skor1 UTSW 9 63146850 missense probably benign 0.02
R7606:Skor1 UTSW 9 63145382 missense probably damaging 1.00
R7664:Skor1 UTSW 9 63141763 missense probably benign 0.08
R7689:Skor1 UTSW 9 63145379 missense probably damaging 1.00
R7793:Skor1 UTSW 9 63144885 missense probably damaging 1.00
R7871:Skor1 UTSW 9 63146501 missense probably damaging 1.00
R7911:Skor1 UTSW 9 63145046 missense possibly damaging 0.50
R8399:Skor1 UTSW 9 63145158 missense possibly damaging 0.50
R8546:Skor1 UTSW 9 63142288 missense probably damaging 1.00
Z1176:Skor1 UTSW 9 63145130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCGACTTGTCACTGAGTTTGAGG -3'
(R):5'- TACCCATCGTGTCGCTGGTCATTG -3'

Sequencing Primer
(F):5'- CTTGTTGGGAGAGAAATACATACTGC -3'
(R):5'- ATTGATGGGCAGGAGCG -3'
Posted On2014-04-13