Mutagenetix > Incidental Mutations

Incidental Mutation 'R1581:Nav3'

171419

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

039618-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109823428 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 776 (D776G)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032719
AA Change: D776G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: D776G

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161582

SMART Domains

Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
low complexity region	84	95	N/A	INTRINSIC
low complexity region	150	173	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	354	372	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	551	562	N/A	INTRINSIC
low complexity region	570	589	N/A	INTRINSIC
low complexity region	604	618	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
coiled coil region	842	933	N/A	INTRINSIC
low complexity region	952	969	N/A	INTRINSIC
low complexity region	992	1003	N/A	INTRINSIC
low complexity region	1026	1051	N/A	INTRINSIC
low complexity region	1052	1065	N/A	INTRINSIC
coiled coil region	1071	1112	N/A	INTRINSIC
low complexity region	1118	1141	N/A	INTRINSIC
AAA	1299	1454	4.94e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	C	15: 91,179,144	E447G	probably benign	Het
Actn4	T	C	7: 28,898,646	T510A	probably benign	Het
Adgrb3	A	G	1: 25,094,072	M1311T	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bicdl1	G	T	5: 115,651,267		probably benign	Het
Bmyc	T	C	2: 25,707,334	S137P	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Casc3	C	T	11: 98,822,818	T292I	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cnnm2	A	G	19: 46,763,123	T451A	probably damaging	Het
Eed	T	C	7: 89,980,468	K20E	possibly damaging	Het
Eps15	T	A	4: 109,363,186	M180K	probably benign	Het
Esr1	T	C	10: 4,997,905	I486T	probably damaging	Het
Etnppl	A	G	3: 130,628,744	I207V	possibly damaging	Het
Fam92a	T	A	4: 12,155,745		probably null	Het
Fancg	G	A	4: 43,007,039	P246L	probably damaging	Het
Fcrl1	G	A	3: 87,385,723	C249Y	possibly damaging	Het
Foxred2	A	G	15: 77,955,761	F110L	possibly damaging	Het
Fsip2	A	T	2: 82,986,282	N4120Y	probably damaging	Het
Gm156	T	C	6: 129,775,833	D3G	probably benign	Het
Gm4884	C	T	7: 41,043,831	S408L	probably benign	Het
Gm9476	T	C	10: 100,306,612		noncoding transcript	Het
Gria1	T	C	11: 57,237,010		probably null	Het
H6pd	T	A	4: 149,982,514	I472F	possibly damaging	Het
Hydin	A	T	8: 110,410,460	M632L	probably benign	Het
Hyou1	C	T	9: 44,388,870	P819S	probably damaging	Het
Il6st	A	G	13: 112,481,541	E163G	probably damaging	Het
Kcnk1	T	C	8: 125,995,539	V27A	possibly damaging	Het
Kdelr3	T	C	15: 79,522,913		probably null	Het
Klk1b22	A	G	7: 44,115,975	N117S	possibly damaging	Het
Lpp	C	A	16: 24,681,841	C134*	probably null	Het
Lrrc37a	G	A	11: 103,457,017	R2951*	probably null	Het
Luzp2	T	A	7: 55,249,490	D285E	possibly damaging	Het
Ly75	C	T	2: 60,327,893	R1016H	probably damaging	Het
Mesp2	T	A	7: 79,812,541	S282T	possibly damaging	Het
Nr2e1	T	C	10: 42,567,968	T253A	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr398	A	T	11: 73,984,521	L29H	probably damaging	Het
Padi6	T	C	4: 140,735,836	Y146C	probably damaging	Het
Pank4	C	T	4: 154,974,651	R414W	probably damaging	Het
Pclo	T	G	5: 14,521,282	I227S	probably benign	Het
Plppr4	A	G	3: 117,328,266	V221A	possibly damaging	Het
Pradc1	G	A	6: 85,448,586	R25C	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rnd2	A	G	11: 101,471,196	T192A	probably benign	Het
Rtbdn	A	G	8: 84,955,066	E131G	probably benign	Het
Ryr2	A	G	13: 11,794,563	V792A	probably benign	Het
Sacs	G	T	14: 61,213,679	Q4391H	probably damaging	Het
Scd2	A	G	19: 44,298,099	S123G	probably benign	Het
Sept9	A	G	11: 117,290,595	R74G	probably damaging	Het
Sipa1l2	T	A	8: 125,491,617	Q327L	probably damaging	Het
Skor1	T	C	9: 63,146,223	T127A	probably damaging	Het
Sphk2	A	G	7: 45,713,496	V57A	probably damaging	Het
Tfec	A	T	6: 16,844,244	D101E	probably damaging	Het
Tmem43	T	A	6: 91,478,735	H109Q	probably benign	Het
Tmem67	C	A	4: 12,047,814	S839I	probably damaging	Het
Trpv5	T	C	6: 41,653,140	Y672C	probably damaging	Het
Ttc39d	A	C	17: 80,216,484	S191R	probably benign	Het
Ttll1	C	T	15: 83,496,277	V296M	probably damaging	Het
Upp2	A	C	2: 58,774,165	K130T	possibly damaging	Het
Vmn2r5	A	G	3: 64,491,219	C780R	probably damaging	Het
Wars	C	A	12: 108,875,709	E171*	probably null	Het
Zeb2	A	T	2: 44,997,000	S637T	probably damaging	Het
Zfp27	T	A	7: 29,896,124	T139S	possibly damaging	Het
Zfp941	A	T	7: 140,812,120	L442Q	probably benign	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
R7876:Nav3	UTSW	10	109853498	missense	probably benign	0.26
R8048:Nav3	UTSW	10	109764918	missense	probably benign	0.13
R8104:Nav3	UTSW	10	109758967	missense	probably damaging	0.99
R8125:Nav3	UTSW	10	109852659	missense	probably damaging	0.99
R8275:Nav3	UTSW	10	109692123	missense	noncoding transcript
R8325:Nav3	UTSW	10	109705603	missense	probably benign	0.24
R8336:Nav3	UTSW	10	109767569	missense	probably damaging	0.99
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCTCAGAGCTACTTACCCACTG -3'
(R):5'- CCCTGGAGACAACCTTTGATACGAC -3'

Sequencing Primer
(F):5'- GATATCATCCGCTCTCAGACTC -3'
(R):5'- GACAACCTTTGATACGACTGTGAC -3'

Posted On

2014-04-13