Incidental Mutation 'R1581:Nav3'
ID171419
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109823428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 776 (D776G)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: D776G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: D776G

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTCAGAGCTACTTACCCACTG -3'
(R):5'- CCCTGGAGACAACCTTTGATACGAC -3'

Sequencing Primer
(F):5'- GATATCATCCGCTCTCAGACTC -3'
(R):5'- GACAACCTTTGATACGACTGTGAC -3'
Posted On2014-04-13