Incidental Mutation 'R1581:Auh'
ID171430
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene NameAU RNA binding protein/enoyl-coenzyme A hydratase
SynonymsW91705
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location52835119-52929681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52835496 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 308 (P308L)
Ref Sequence ENSEMBL: ENSMUSP00000021913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913]
Predicted Effect probably benign
Transcript: ENSMUST00000021913
AA Change: P308L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460
AA Change: P308L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137064
SMART Domains Protein: ENSMUSP00000121852
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
Pfam:ECH_2 1 179 1.9e-28 PFAM
Pfam:ECH_1 1 236 1.1e-51 PFAM
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1480:Auh UTSW 13 52835496 missense probably benign 0.00
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2429:Auh UTSW 13 52919016 missense probably damaging 1.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R2960:Auh UTSW 13 52839574 missense probably damaging 1.00
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6434:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R7615:Auh UTSW 13 52919013 missense probably benign 0.00
R8379:Auh UTSW 13 52909313 makesense probably null
R8774:Auh UTSW 13 52839595 missense probably benign 0.21
R8774-TAIL:Auh UTSW 13 52839595 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CGTGTTTTGACCACGGACATTGC -3'
(R):5'- TGTGTGCTCTGATCCAGGCCATTG -3'

Sequencing Primer
(F):5'- CTGAATAAATATGACATGGCGCAC -3'
(R):5'- TGGCCCCATTGTTAGGAGAC -3'
Posted On2014-04-13