Incidental Mutation 'R1581:Kdelr3'
List |< first << previous [record 30 of 67] next >> last >|
ID171435
Institutional Source Beutler Lab
Gene Symbol Kdelr3
Ensembl Gene ENSMUSG00000010830
Gene NameKDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Synonyms
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79516411-79527739 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 79522913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010974] [ENSMUST00000054014] [ENSMUST00000229877]
Predicted Effect probably null
Transcript: ENSMUST00000010974
SMART Domains Protein: ENSMUSP00000010974
Gene: ENSMUSG00000010830

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 3.3e-54 PFAM
transmembrane domain 179 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054014
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229877
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Kdelr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Kdelr3 APN 15 79522847 missense probably damaging 1.00
IGL01772:Kdelr3 APN 15 79522920 unclassified probably benign
IGL02437:Kdelr3 APN 15 79525787 missense probably damaging 1.00
R2567:Kdelr3 UTSW 15 79522831 missense probably benign
R4851:Kdelr3 UTSW 15 79524865 missense possibly damaging 0.89
R5376:Kdelr3 UTSW 15 79525860 missense possibly damaging 0.93
R5696:Kdelr3 UTSW 15 79525899 splice site probably null
R7407:Kdelr3 UTSW 15 79524838 missense probably damaging 0.99
R8811:Kdelr3 UTSW 15 79525851 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTGTCTCCCTGGTGAATCAGCAGC -3'
(R):5'- GACCTTGATGAATCTCCCAGCCAC -3'

Sequencing Primer
(F):5'- agggcagggcagggATAG -3'
(R):5'- ACCTCTCTGAGTGAAGTACAAG -3'
Posted On2014-04-13