Incidental Mutation 'R1581:Cnnm2'
ID171444
Institutional Source Beutler Lab
Gene Symbol Cnnm2
Ensembl Gene ENSMUSG00000064105
Gene Namecyclin M2
SynonymsAcdp2
MMRRC Submission 039618-MU
Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46761596-46878795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46763123 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 451 (T451A)
Ref Sequence ENSEMBL: ENSMUSP00000096972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]
Predicted Effect probably damaging
Transcript: ENSMUST00000077666
AA Change: T451A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: T451A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 7.8e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 7.6e-6 PFAM
Blast:cNMP 649 805 2e-49 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000099373
AA Change: T451A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: T451A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 2.6e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 1.1e-5 PFAM
Blast:cNMP 649 827 1e-46 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr398 A T 11: 73,984,521 L29H probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Cnnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cnnm2 APN 19 46763220 missense probably damaging 1.00
IGL01971:Cnnm2 APN 19 46871676 missense probably benign 0.19
IGL02003:Cnnm2 APN 19 46868559 missense probably damaging 1.00
IGL02068:Cnnm2 APN 19 46877388 missense possibly damaging 0.94
IGL02185:Cnnm2 APN 19 46762995 missense probably benign 0.45
IGL02652:Cnnm2 APN 19 46763211 missense probably damaging 1.00
IGL02682:Cnnm2 APN 19 46762076 missense probably benign 0.37
IGL03009:Cnnm2 APN 19 46877355 missense probably damaging 1.00
IGL03378:Cnnm2 APN 19 46878034 missense possibly damaging 0.76
R3700:Cnnm2 UTSW 19 46762551 missense probably damaging 1.00
R3892:Cnnm2 UTSW 19 46761793 nonsense probably null
R3911:Cnnm2 UTSW 19 46877936 missense probably damaging 0.96
R4508:Cnnm2 UTSW 19 46877270 missense probably benign 0.01
R4678:Cnnm2 UTSW 19 46763246 missense possibly damaging 0.91
R4878:Cnnm2 UTSW 19 46859083 missense probably benign 0.45
R5154:Cnnm2 UTSW 19 46763132 missense probably benign 0.02
R5445:Cnnm2 UTSW 19 46877288 missense possibly damaging 0.66
R5771:Cnnm2 UTSW 19 46856995 splice site probably null
R5914:Cnnm2 UTSW 19 46763177 missense probably benign 0.07
R6263:Cnnm2 UTSW 19 46856905 missense probably benign 0.30
R6715:Cnnm2 UTSW 19 46853973 missense probably damaging 1.00
R6881:Cnnm2 UTSW 19 46877219 missense probably damaging 1.00
R7022:Cnnm2 UTSW 19 46762550 missense probably damaging 0.98
R7022:Cnnm2 UTSW 19 46858940 splice site probably null
R7486:Cnnm2 UTSW 19 46762074 missense possibly damaging 0.94
R7600:Cnnm2 UTSW 19 46762067 missense probably benign 0.02
R7648:Cnnm2 UTSW 19 46877900 missense probably damaging 0.98
R7800:Cnnm2 UTSW 19 46877981 missense probably benign 0.28
X0017:Cnnm2 UTSW 19 46762463 missense probably benign 0.05
X0018:Cnnm2 UTSW 19 46762773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCGTGCCCCAAGCCATCTG -3'
(R):5'- AGGCCAAGTCTTTGACAAAGAGCAG -3'

Sequencing Primer
(F):5'- ATGATGATGACATTCCCCGC -3'
(R):5'- CAGGTCCACGATGTTGGAAC -3'
Posted On2014-04-13