Mutagenetix > Incidental Mutations

Incidental Mutation 'R1581:Cnnm2'

171444

Institutional Source

Beutler Lab

Gene Symbol

Cnnm2

Ensembl Gene

ENSMUSG00000064105

Gene Name

cyclin M2

Synonyms

Acdp2

MMRRC Submission

039618-MU

Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46761596-46878795 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46763123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 451 (T451A)

Ref Sequence

ENSEMBL: ENSMUSP00000096972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]

AlphaFold

Q3TWN3

Predicted Effect

probably damaging
Transcript: ENSMUST00000077666
AA Change: T451A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: T451A

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
low complexity region	194	227	N/A	INTRINSIC
Pfam:DUF21	257	431	7.8e-39	PFAM
Blast:CBS	455	505	3e-14	BLAST
Pfam:CBS	514	578	7.6e-6	PFAM
Blast:cNMP	649	805	2e-49	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000099373
AA Change: T451A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: T451A

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
low complexity region	194	227	N/A	INTRINSIC
Pfam:DUF21	257	431	2.6e-39	PFAM
Blast:CBS	455	505	3e-14	BLAST
Pfam:CBS	514	578	1.1e-5	PFAM
Blast:cNMP	649	827	1e-46	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	C	15: 91,179,144	E447G	probably benign	Het
Actn4	T	C	7: 28,898,646	T510A	probably benign	Het
Adgrb3	A	G	1: 25,094,072	M1311T	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bicdl1	G	T	5: 115,651,267		probably benign	Het
Bmyc	T	C	2: 25,707,334	S137P	probably damaging	Het
Camsap3	C	T	8: 3,604,708	R782C	probably damaging	Het
Casc3	C	T	11: 98,822,818	T292I	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Eed	T	C	7: 89,980,468	K20E	possibly damaging	Het
Eps15	T	A	4: 109,363,186	M180K	probably benign	Het
Esr1	T	C	10: 4,997,905	I486T	probably damaging	Het
Etnppl	A	G	3: 130,628,744	I207V	possibly damaging	Het
Fam92a	T	A	4: 12,155,745		probably null	Het
Fancg	G	A	4: 43,007,039	P246L	probably damaging	Het
Fcrl1	G	A	3: 87,385,723	C249Y	possibly damaging	Het
Foxred2	A	G	15: 77,955,761	F110L	possibly damaging	Het
Fsip2	A	T	2: 82,986,282	N4120Y	probably damaging	Het
Gm156	T	C	6: 129,775,833	D3G	probably benign	Het
Gm4884	C	T	7: 41,043,831	S408L	probably benign	Het
Gm9476	T	C	10: 100,306,612		noncoding transcript	Het
Gria1	T	C	11: 57,237,010		probably null	Het
H6pd	T	A	4: 149,982,514	I472F	possibly damaging	Het
Hydin	A	T	8: 110,410,460	M632L	probably benign	Het
Hyou1	C	T	9: 44,388,870	P819S	probably damaging	Het
Il6st	A	G	13: 112,481,541	E163G	probably damaging	Het
Kcnk1	T	C	8: 125,995,539	V27A	possibly damaging	Het
Kdelr3	T	C	15: 79,522,913		probably null	Het
Klk1b22	A	G	7: 44,115,975	N117S	possibly damaging	Het
Lpp	C	A	16: 24,681,841	C134*	probably null	Het
Lrrc37a	G	A	11: 103,457,017	R2951*	probably null	Het
Luzp2	T	A	7: 55,249,490	D285E	possibly damaging	Het
Ly75	C	T	2: 60,327,893	R1016H	probably damaging	Het
Mesp2	T	A	7: 79,812,541	S282T	possibly damaging	Het
Nav3	T	C	10: 109,823,428	D776G	probably damaging	Het
Nr2e1	T	C	10: 42,567,968	T253A	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr398	A	T	11: 73,984,521	L29H	probably damaging	Het
Padi6	T	C	4: 140,735,836	Y146C	probably damaging	Het
Pank4	C	T	4: 154,974,651	R414W	probably damaging	Het
Pclo	T	G	5: 14,521,282	I227S	probably benign	Het
Plppr4	A	G	3: 117,328,266	V221A	possibly damaging	Het
Pradc1	G	A	6: 85,448,586	R25C	probably damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rnd2	A	G	11: 101,471,196	T192A	probably benign	Het
Rtbdn	A	G	8: 84,955,066	E131G	probably benign	Het
Ryr2	A	G	13: 11,794,563	V792A	probably benign	Het
Sacs	G	T	14: 61,213,679	Q4391H	probably damaging	Het
Scd2	A	G	19: 44,298,099	S123G	probably benign	Het
Sept9	A	G	11: 117,290,595	R74G	probably damaging	Het
Sipa1l2	T	A	8: 125,491,617	Q327L	probably damaging	Het
Skor1	T	C	9: 63,146,223	T127A	probably damaging	Het
Sphk2	A	G	7: 45,713,496	V57A	probably damaging	Het
Tfec	A	T	6: 16,844,244	D101E	probably damaging	Het
Tmem43	T	A	6: 91,478,735	H109Q	probably benign	Het
Tmem67	C	A	4: 12,047,814	S839I	probably damaging	Het
Trpv5	T	C	6: 41,653,140	Y672C	probably damaging	Het
Ttc39d	A	C	17: 80,216,484	S191R	probably benign	Het
Ttll1	C	T	15: 83,496,277	V296M	probably damaging	Het
Upp2	A	C	2: 58,774,165	K130T	possibly damaging	Het
Vmn2r5	A	G	3: 64,491,219	C780R	probably damaging	Het
Wars	C	A	12: 108,875,709	E171*	probably null	Het
Zeb2	A	T	2: 44,997,000	S637T	probably damaging	Het
Zfp27	T	A	7: 29,896,124	T139S	possibly damaging	Het
Zfp941	A	T	7: 140,812,120	L442Q	probably benign	Het

Other mutations in Cnnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Cnnm2	APN	19	46763220	missense	probably damaging	1.00
IGL01971:Cnnm2	APN	19	46871676	missense	probably benign	0.19
IGL02003:Cnnm2	APN	19	46868559	missense	probably damaging	1.00
IGL02068:Cnnm2	APN	19	46877388	missense	possibly damaging	0.94
IGL02185:Cnnm2	APN	19	46762995	missense	probably benign	0.45
IGL02652:Cnnm2	APN	19	46763211	missense	probably damaging	1.00
IGL02682:Cnnm2	APN	19	46762076	missense	probably benign	0.37
IGL03009:Cnnm2	APN	19	46877355	missense	probably damaging	1.00
IGL03378:Cnnm2	APN	19	46878034	missense	possibly damaging	0.76
R3700:Cnnm2	UTSW	19	46762551	missense	probably damaging	1.00
R3892:Cnnm2	UTSW	19	46761793	nonsense	probably null
R3911:Cnnm2	UTSW	19	46877936	missense	probably damaging	0.96
R4508:Cnnm2	UTSW	19	46877270	missense	probably benign	0.01
R4678:Cnnm2	UTSW	19	46763246	missense	possibly damaging	0.91
R4878:Cnnm2	UTSW	19	46859083	missense	probably benign	0.45
R5154:Cnnm2	UTSW	19	46763132	missense	probably benign	0.02
R5445:Cnnm2	UTSW	19	46877288	missense	possibly damaging	0.66
R5771:Cnnm2	UTSW	19	46856995	splice site	probably null
R5914:Cnnm2	UTSW	19	46763177	missense	probably benign	0.07
R6263:Cnnm2	UTSW	19	46856905	missense	probably benign	0.30
R6715:Cnnm2	UTSW	19	46853973	missense	probably damaging	1.00
R6881:Cnnm2	UTSW	19	46877219	missense	probably damaging	1.00
R7022:Cnnm2	UTSW	19	46762550	missense	probably damaging	0.98
R7022:Cnnm2	UTSW	19	46858940	splice site	probably null
R7486:Cnnm2	UTSW	19	46762074	missense	possibly damaging	0.94
R7600:Cnnm2	UTSW	19	46762067	missense	probably benign	0.02
R7648:Cnnm2	UTSW	19	46877900	missense	probably damaging	0.98
R7800:Cnnm2	UTSW	19	46877981	missense	probably benign	0.28
R8867:Cnnm2	UTSW	19	46762557	missense	probably damaging	0.99
R8971:Cnnm2	UTSW	19	46856923	missense	probably benign	0.28
R9433:Cnnm2	UTSW	19	46762368	missense	probably benign	0.23
R9463:Cnnm2	UTSW	19	46762551	missense	probably damaging	1.00
X0017:Cnnm2	UTSW	19	46762463	missense	probably benign	0.05
X0018:Cnnm2	UTSW	19	46762773	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATCGTGCCCCAAGCCATCTG -3'
(R):5'- AGGCCAAGTCTTTGACAAAGAGCAG -3'

Sequencing Primer
(F):5'- ATGATGATGACATTCCCCGC -3'
(R):5'- CAGGTCCACGATGTTGGAAC -3'

Posted On

2014-04-13