Incidental Mutation 'R1582:Usp21'
ID171449
Institutional Source Beutler Lab
Gene Symbol Usp21
Ensembl Gene ENSMUSG00000053483
Gene Nameubiquitin specific peptidase 21
SynonymsUsp23, W53272, ESTM28, Usp16
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1582 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171281945-171287991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171283081 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 444 (C444S)
Ref Sequence ENSEMBL: ENSMUSP00000106938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000149187] [ENSMUST00000192956]
Predicted Effect probably damaging
Transcript: ENSMUST00000065941
AA Change: C441S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483
AA Change: C441S

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111305
AA Change: C441S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483
AA Change: C441S

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111306
AA Change: C444S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483
AA Change: C444S

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147176
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000174720
SMART Domains Protein: ENSMUSP00000133362
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
Pfam:UCH 77 162 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but develop splenomegaly, show an increased percentage of macrophages and neutrophils in spleen, and are more resistant to vesicular stomatitis virus (VSV) infection with elevated interferon production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Usp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Usp21 APN 1 171283402 missense probably damaging 0.96
IGL01726:Usp21 APN 1 171284001 missense probably damaging 1.00
IGL01915:Usp21 APN 1 171282733 missense possibly damaging 0.92
IGL02504:Usp21 APN 1 171285023 missense probably benign 0.39
IGL02646:Usp21 APN 1 171283095 unclassified probably benign
R0513:Usp21 UTSW 1 171283012 unclassified probably benign
R0513:Usp21 UTSW 1 171283014 unclassified probably benign
R0570:Usp21 UTSW 1 171283746 unclassified probably benign
R1700:Usp21 UTSW 1 171283722 missense probably damaging 1.00
R4061:Usp21 UTSW 1 171285401 unclassified probably benign
R4073:Usp21 UTSW 1 171282172 unclassified probably benign
R5914:Usp21 UTSW 1 171282171 unclassified probably benign
R6879:Usp21 UTSW 1 171282503 missense probably damaging 1.00
R7611:Usp21 UTSW 1 171285569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTGGCAGGTTTTCCCTAAG -3'
(R):5'- AGAGTCGGAGAATGCCCCAGTATG -3'

Sequencing Primer
(F):5'- TCCCTAAGGGAAACTCAAACG -3'
(R):5'- AAGGGAAATGCATGTCTCCTTG -3'
Posted On2014-04-13