Incidental Mutation 'R1582:Kctd19'
ID171477
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1582 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105395460 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 152 (L152F)
Ref Sequence ENSEMBL: ENSMUSP00000130831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063071] [ENSMUST00000167294] [ENSMUST00000168888]
Predicted Effect probably damaging
Transcript: ENSMUST00000063071
AA Change: L152F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: L152F

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000167294
AA Change: L152F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: L152F

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect silent
Transcript: ENSMUST00000168888
SMART Domains Protein: ENSMUSP00000131732
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 95 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAAGCGGAACTCGCTGCATTC -3'
(R):5'- AAGTCCCTATGCTGGGACATCAGG -3'

Sequencing Primer
(F):5'- ATTCGCACTCGATCAGGG -3'
(R):5'- tgaggacccagaacccac -3'
Posted On2014-04-13