Incidental Mutation 'R1582:Ddx25'
ID171479
Institutional Source Beutler Lab
Gene Symbol Ddx25
Ensembl Gene ENSMUSG00000032101
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 25
SynonymsGRTH
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R1582 (G1)
Quality Score216
Status Not validated
Chromosome9
Chromosomal Location35536647-35558528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35545976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 348 (T348A)
Ref Sequence ENSEMBL: ENSMUSP00000034612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612]
Predicted Effect probably damaging
Transcript: ENSMUST00000034612
AA Change: T348A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101
AA Change: T348A

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrest of spermatogenesis at step 8, abnormal Leydig cells, and increased germ cell apoptosis in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Ddx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ddx25 APN 9 35543595 splice site probably benign
IGL00951:Ddx25 APN 9 35552835 critical splice donor site probably null
IGL02237:Ddx25 APN 9 35542069 splice site probably benign
IGL02270:Ddx25 APN 9 35554412 splice site probably benign
IGL02273:Ddx25 APN 9 35546826 missense possibly damaging 0.95
IGL02325:Ddx25 APN 9 35554508 unclassified probably benign
IGL02422:Ddx25 APN 9 35551364 missense probably null 1.00
IGL02440:Ddx25 APN 9 35557678 unclassified probably benign
IGL02798:Ddx25 APN 9 35551397 missense probably damaging 1.00
IGL03339:Ddx25 APN 9 35542003 missense probably damaging 1.00
R0633:Ddx25 UTSW 9 35545972 missense probably damaging 0.99
R0893:Ddx25 UTSW 9 35554390 nonsense probably null
R1171:Ddx25 UTSW 9 35546846 nonsense probably null
R1448:Ddx25 UTSW 9 35557738 missense probably benign
R1453:Ddx25 UTSW 9 35542002 missense probably damaging 1.00
R3055:Ddx25 UTSW 9 35551351 missense probably damaging 1.00
R5960:Ddx25 UTSW 9 35554511 splice site probably null
R7425:Ddx25 UTSW 9 35554586 missense probably benign 0.08
R7535:Ddx25 UTSW 9 35543655 missense possibly damaging 0.89
R7610:Ddx25 UTSW 9 35554597 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAACGCCCAGCTTTGACATAC -3'
(R):5'- AAGGTCAGCTCTGCTCCAGGATAG -3'

Sequencing Primer
(F):5'- TCTGAATGATGGAAGCTCGC -3'
(R):5'- gaggaggaggaggtggaag -3'
Posted On2014-04-13