Incidental Mutation 'R1582:Ddhd1'
ID 171493
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
MMRRC Submission 039619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1582 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45842566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 630 (L630I)
Ref Sequence ENSEMBL: ENSMUSP00000107459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000051310
AA Change: L630I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: L630I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087320
AA Change: L664I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: L664I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: L630I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: L630I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect probably benign
Transcript: ENSMUST00000141487
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect probably benign
Transcript: ENSMUST00000156758
SMART Domains Protein: ENSMUSP00000121837
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
DDHD 1 168 3.8e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,690,371 (GRCm39) A630G probably damaging Het
Actr3 A G 1: 125,333,662 (GRCm39) Y202H probably benign Het
Adamts19 A G 18: 59,103,013 (GRCm39) N685D probably damaging Het
Atl3 A G 19: 7,494,264 (GRCm39) T138A probably damaging Het
Bpifa2 T C 2: 153,855,638 (GRCm39) S188P probably damaging Het
Bsn T C 9: 107,982,291 (GRCm39) T3821A unknown Het
Dcun1d2 A G 8: 13,330,926 (GRCm39) L68P probably damaging Het
Ddx25 T C 9: 35,457,272 (GRCm39) T348A probably damaging Het
Dtnb C T 12: 3,823,554 (GRCm39) T580M possibly damaging Het
Dysf A G 6: 84,074,749 (GRCm39) S561G probably damaging Het
Ehbp1l1 A G 19: 5,771,995 (GRCm39) I101T possibly damaging Het
Erich3 T C 3: 154,469,960 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam135a T C 1: 24,068,398 (GRCm39) T611A probably damaging Het
Gpbp1 T C 13: 111,573,066 (GRCm39) probably null Het
H2-Oa A T 17: 34,313,695 (GRCm39) T218S probably damaging Het
Kctd19 G A 8: 106,122,092 (GRCm39) L152F probably damaging Het
Kdm5b T A 1: 134,552,591 (GRCm39) M1189K probably damaging Het
Kif13a A G 13: 46,947,398 (GRCm39) V862A probably benign Het
Lct T C 1: 128,228,299 (GRCm39) T1065A probably damaging Het
Mark3 G A 12: 111,621,744 (GRCm39) A697T probably benign Het
Mosmo A G 7: 120,329,728 (GRCm39) I116M possibly damaging Het
Mpped1 C T 15: 83,676,191 (GRCm39) probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Muc15 A T 2: 110,567,817 (GRCm39) M321L probably benign Het
Naa25 T A 5: 121,572,892 (GRCm39) N670K probably benign Het
Or1e1c T A 11: 73,266,090 (GRCm39) C172S probably damaging Het
Or5e1 G T 7: 108,354,317 (GRCm39) V85L probably benign Het
Or6z3 A G 7: 6,463,813 (GRCm39) M102V probably benign Het
Ppara T C 15: 85,682,429 (GRCm39) I375T possibly damaging Het
Prss27 A G 17: 24,263,877 (GRCm39) I188V probably benign Het
Rbms1 A T 2: 60,589,179 (GRCm39) M287K possibly damaging Het
Relt C T 7: 100,500,560 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sec24a A G 11: 51,599,794 (GRCm39) V837A probably benign Het
Smarca2 G A 19: 26,729,305 (GRCm39) D19N probably damaging Het
Sorbs2 G A 8: 46,258,814 (GRCm39) G620D probably damaging Het
Spata31d1c C A 13: 65,181,038 (GRCm39) Q46K probably benign Het
Spata6 C G 4: 111,637,992 (GRCm39) S274* probably null Het
Spata6 C T 4: 111,637,994 (GRCm39) P275S probably benign Het
Tas2r108 T A 6: 40,470,566 (GRCm39) V14D probably benign Het
Thbs2 G T 17: 14,891,550 (GRCm39) P996T probably damaging Het
Tmem131l T C 3: 83,839,090 (GRCm39) Q620R probably damaging Het
Ubap2l A G 3: 89,941,978 (GRCm39) S203P probably damaging Het
Unc45b G A 11: 82,816,771 (GRCm39) G404S probably benign Het
Uri1 A G 7: 37,664,811 (GRCm39) S292P possibly damaging Het
Usp21 A T 1: 171,110,655 (GRCm39) C444S probably damaging Het
Vmn1r117 A T 7: 20,617,484 (GRCm39) V188D possibly damaging Het
Vmn1r7 T C 6: 57,002,143 (GRCm39) D39G probably damaging Het
Wdr25 T C 12: 108,863,980 (GRCm39) F42L possibly damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4541:Ddhd1 UTSW 14 45,860,313 (GRCm39) nonsense probably null
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6218:Ddhd1 UTSW 14 45,851,633 (GRCm39) missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45,894,689 (GRCm39) frame shift probably null
R6787:Ddhd1 UTSW 14 45,894,976 (GRCm39) missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45,840,138 (GRCm39) missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGCTTACAGTGCGTAAAGCAGATGT -3'
(R):5'- AGCCTCAGAGTTGGAGGCAACTTA -3'

Sequencing Primer
(F):5'- gacgacggggaccaaac -3'
(R):5'- GAGTTGGAGGCAACTTACTTAAAAC -3'
Posted On 2014-04-13