Mutagenetix > Incidental Mutation

Incidental Mutation 'R1582:Adamts19'

171504

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

039619-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1582 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58969941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 685 (N685D)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: N685D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: N685D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.4%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl1	C	G	2: 31,800,359	A630G	probably damaging	Het
Actr3	A	G	1: 125,405,925	Y202H	probably benign	Het
Atl3	A	G	19: 7,516,899	T138A	probably damaging	Het
Bpifa2	T	C	2: 154,013,718	S188P	probably damaging	Het
Bsn	T	C	9: 108,105,092	T3821A	unknown	Het
Dcun1d2	A	G	8: 13,280,926	L68P	probably damaging	Het
Ddhd1	A	T	14: 45,605,109	L630I	probably damaging	Het
Ddx25	T	C	9: 35,545,976	T348A	probably damaging	Het
Dtnb	C	T	12: 3,773,554	T580M	possibly damaging	Het
Dysf	A	G	6: 84,097,767	S561G	probably damaging	Het
Ehbp1l1	A	G	19: 5,721,967	I101T	possibly damaging	Het
Erich3	T	C	3: 154,764,323		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam135a	T	C	1: 24,029,317	T611A	probably damaging	Het
Gpbp1	T	C	13: 111,436,532		probably null	Het
H2-Oa	A	T	17: 34,094,721	T218S	probably damaging	Het
Kctd19	G	A	8: 105,395,460	L152F	probably damaging	Het
Kdm5b	T	A	1: 134,624,853	M1189K	probably damaging	Het
Kif13a	A	G	13: 46,793,922	V862A	probably benign	Het
Lct	T	C	1: 128,300,562	T1065A	probably damaging	Het
Mark3	G	A	12: 111,655,310	A697T	probably benign	Het
Mosmo	A	G	7: 120,730,505	I116M	possibly damaging	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Muc15	A	T	2: 110,737,472	M321L	probably benign	Het
Naa25	T	A	5: 121,434,829	N670K	probably benign	Het
Olfr1336	A	G	7: 6,460,814	M102V	probably benign	Het
Olfr376	T	A	11: 73,375,264	C172S	probably damaging	Het
Olfr513	G	T	7: 108,755,110	V85L	probably benign	Het
Ppara	T	C	15: 85,798,228	I375T	possibly damaging	Het
Prss27	A	G	17: 24,044,903	I188V	probably benign	Het
Rbms1	A	T	2: 60,758,835	M287K	possibly damaging	Het
Relt	C	T	7: 100,851,353		probably null	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Sec24a	A	G	11: 51,708,967	V837A	probably benign	Het
Smarca2	G	A	19: 26,751,905	D19N	probably damaging	Het
Sorbs2	G	A	8: 45,805,777	G620D	probably damaging	Het
Spata31d1c	C	A	13: 65,033,224	Q46K	probably benign	Het
Spata6	C	G	4: 111,780,795	S274*	probably null	Het
Spata6	C	T	4: 111,780,797	P275S	probably benign	Het
Tas2r108	T	A	6: 40,493,632	V14D	probably benign	Het
Thbs2	G	T	17: 14,671,288	P996T	probably damaging	Het
Tmem131l	T	C	3: 83,931,783	Q620R	probably damaging	Het
Ubap2l	A	G	3: 90,034,671	S203P	probably damaging	Het
Unc45b	G	A	11: 82,925,945	G404S	probably benign	Het
Uri1	A	G	7: 37,965,386	S292P	possibly damaging	Het
Usp21	A	T	1: 171,283,081	C444S	probably damaging	Het
Vmn1r117	A	T	7: 20,883,559	V188D	possibly damaging	Het
Vmn1r7	T	C	6: 57,025,158	D39G	probably damaging	Het
Wdr25	T	C	12: 108,898,054	F42L	possibly damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGTTGCACCGAGTTCTGCCC -3'
(R):5'- GGTTGTTATATGCCAGTGAGGTCAGAAA -3'

Sequencing Primer
(F):5'- TAAGCCTATAAATGCCCTGCTC -3'
(R):5'- CCAGTGAGGTCAGAAAAAAAAAATG -3'

Posted On

2014-04-13