Incidental Mutation 'R1582:Adamts19'
ID 171504
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms D230034E10Rik
MMRRC Submission 039619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1582 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 58969739-59187132 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59103013 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 685 (N685D)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
AlphaFold P59509
Predicted Effect probably damaging
Transcript: ENSMUST00000052907
AA Change: N685D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: N685D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,690,371 (GRCm39) A630G probably damaging Het
Actr3 A G 1: 125,333,662 (GRCm39) Y202H probably benign Het
Atl3 A G 19: 7,494,264 (GRCm39) T138A probably damaging Het
Bpifa2 T C 2: 153,855,638 (GRCm39) S188P probably damaging Het
Bsn T C 9: 107,982,291 (GRCm39) T3821A unknown Het
Dcun1d2 A G 8: 13,330,926 (GRCm39) L68P probably damaging Het
Ddhd1 A T 14: 45,842,566 (GRCm39) L630I probably damaging Het
Ddx25 T C 9: 35,457,272 (GRCm39) T348A probably damaging Het
Dtnb C T 12: 3,823,554 (GRCm39) T580M possibly damaging Het
Dysf A G 6: 84,074,749 (GRCm39) S561G probably damaging Het
Ehbp1l1 A G 19: 5,771,995 (GRCm39) I101T possibly damaging Het
Erich3 T C 3: 154,469,960 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam135a T C 1: 24,068,398 (GRCm39) T611A probably damaging Het
Gpbp1 T C 13: 111,573,066 (GRCm39) probably null Het
H2-Oa A T 17: 34,313,695 (GRCm39) T218S probably damaging Het
Kctd19 G A 8: 106,122,092 (GRCm39) L152F probably damaging Het
Kdm5b T A 1: 134,552,591 (GRCm39) M1189K probably damaging Het
Kif13a A G 13: 46,947,398 (GRCm39) V862A probably benign Het
Lct T C 1: 128,228,299 (GRCm39) T1065A probably damaging Het
Mark3 G A 12: 111,621,744 (GRCm39) A697T probably benign Het
Mosmo A G 7: 120,329,728 (GRCm39) I116M possibly damaging Het
Mpped1 C T 15: 83,676,191 (GRCm39) probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Muc15 A T 2: 110,567,817 (GRCm39) M321L probably benign Het
Naa25 T A 5: 121,572,892 (GRCm39) N670K probably benign Het
Or1e1c T A 11: 73,266,090 (GRCm39) C172S probably damaging Het
Or5e1 G T 7: 108,354,317 (GRCm39) V85L probably benign Het
Or6z3 A G 7: 6,463,813 (GRCm39) M102V probably benign Het
Ppara T C 15: 85,682,429 (GRCm39) I375T possibly damaging Het
Prss27 A G 17: 24,263,877 (GRCm39) I188V probably benign Het
Rbms1 A T 2: 60,589,179 (GRCm39) M287K possibly damaging Het
Relt C T 7: 100,500,560 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Sec24a A G 11: 51,599,794 (GRCm39) V837A probably benign Het
Smarca2 G A 19: 26,729,305 (GRCm39) D19N probably damaging Het
Sorbs2 G A 8: 46,258,814 (GRCm39) G620D probably damaging Het
Spata31d1c C A 13: 65,181,038 (GRCm39) Q46K probably benign Het
Spata6 C G 4: 111,637,992 (GRCm39) S274* probably null Het
Spata6 C T 4: 111,637,994 (GRCm39) P275S probably benign Het
Tas2r108 T A 6: 40,470,566 (GRCm39) V14D probably benign Het
Thbs2 G T 17: 14,891,550 (GRCm39) P996T probably damaging Het
Tmem131l T C 3: 83,839,090 (GRCm39) Q620R probably damaging Het
Ubap2l A G 3: 89,941,978 (GRCm39) S203P probably damaging Het
Unc45b G A 11: 82,816,771 (GRCm39) G404S probably benign Het
Uri1 A G 7: 37,664,811 (GRCm39) S292P possibly damaging Het
Usp21 A T 1: 171,110,655 (GRCm39) C444S probably damaging Het
Vmn1r117 A T 7: 20,617,484 (GRCm39) V188D possibly damaging Het
Vmn1r7 T C 6: 57,002,143 (GRCm39) D39G probably damaging Het
Wdr25 T C 12: 108,863,980 (GRCm39) F42L possibly damaging Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59,157,537 (GRCm39) missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59,140,397 (GRCm39) splice site probably benign
IGL00970:Adamts19 APN 18 59,144,149 (GRCm39) missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59,181,954 (GRCm39) missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 59,105,851 (GRCm39) missense probably damaging 0.98
IGL01529:Adamts19 APN 18 59,096,535 (GRCm39) missense probably damaging 0.99
IGL01535:Adamts19 APN 18 59,101,891 (GRCm39) missense probably benign 0.00
IGL01557:Adamts19 APN 18 59,101,792 (GRCm39) splice site probably null
IGL01705:Adamts19 APN 18 59,166,038 (GRCm39) missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 59,085,541 (GRCm39) missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58,970,571 (GRCm39) missense probably benign
IGL02131:Adamts19 APN 18 59,185,732 (GRCm39) missense probably damaging 1.00
IGL02312:Adamts19 APN 18 59,060,369 (GRCm39) missense probably damaging 1.00
IGL02755:Adamts19 APN 18 59,103,005 (GRCm39) missense probably benign 0.25
IGL02866:Adamts19 APN 18 59,181,914 (GRCm39) missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 59,122,037 (GRCm39) missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59,157,590 (GRCm39) missense probably damaging 1.00
IGL03040:Adamts19 APN 18 59,036,080 (GRCm39) missense probably benign 0.05
R0081:Adamts19 UTSW 18 59,036,137 (GRCm39) critical splice donor site probably null
R0194:Adamts19 UTSW 18 59,144,220 (GRCm39) missense probably null 1.00
R0195:Adamts19 UTSW 18 59,102,942 (GRCm39) splice site probably benign
R0541:Adamts19 UTSW 18 59,060,372 (GRCm39) critical splice donor site probably null
R0659:Adamts19 UTSW 18 59,140,565 (GRCm39) splice site probably benign
R0967:Adamts19 UTSW 18 59,105,812 (GRCm39) nonsense probably null
R1512:Adamts19 UTSW 18 59,181,917 (GRCm39) missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59,185,687 (GRCm39) missense probably damaging 1.00
R1629:Adamts19 UTSW 18 59,087,691 (GRCm39) missense probably damaging 0.97
R1653:Adamts19 UTSW 18 59,023,365 (GRCm39) missense probably benign 0.00
R1718:Adamts19 UTSW 18 59,105,897 (GRCm39) missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59,165,001 (GRCm39) missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 59,087,692 (GRCm39) missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59,166,017 (GRCm39) missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 59,103,078 (GRCm39) missense probably benign 0.09
R1994:Adamts19 UTSW 18 59,105,903 (GRCm39) critical splice donor site probably null
R2177:Adamts19 UTSW 18 59,087,626 (GRCm39) missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 59,033,982 (GRCm39) missense probably damaging 1.00
R4342:Adamts19 UTSW 18 59,075,572 (GRCm39) missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58,970,848 (GRCm39) missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 59,023,356 (GRCm39) missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59,166,072 (GRCm39) missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59,164,876 (GRCm39) nonsense probably null
R5116:Adamts19 UTSW 18 59,036,066 (GRCm39) missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 59,101,880 (GRCm39) missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59,185,654 (GRCm39) missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58,971,040 (GRCm39) missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58,970,584 (GRCm39) missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 59,101,846 (GRCm39) missense probably benign 0.18
R6088:Adamts19 UTSW 18 59,035,174 (GRCm39) missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58,970,712 (GRCm39) nonsense probably null
R7251:Adamts19 UTSW 18 58,970,974 (GRCm39) missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58,970,955 (GRCm39) missense probably damaging 1.00
R7974:Adamts19 UTSW 18 59,144,094 (GRCm39) missense possibly damaging 0.72
R7991:Adamts19 UTSW 18 59,185,726 (GRCm39) missense probably damaging 1.00
R8129:Adamts19 UTSW 18 59,140,559 (GRCm39) critical splice donor site probably null
R8297:Adamts19 UTSW 18 58,970,920 (GRCm39) missense probably damaging 1.00
R8336:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R8358:Adamts19 UTSW 18 59,181,881 (GRCm39) missense probably damaging 1.00
R8864:Adamts19 UTSW 18 59,023,497 (GRCm39) nonsense probably null
R9051:Adamts19 UTSW 18 59,034,048 (GRCm39) missense probably damaging 1.00
R9253:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R9423:Adamts19 UTSW 18 59,023,427 (GRCm39) missense possibly damaging 0.89
R9610:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9611:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9686:Adamts19 UTSW 18 58,971,093 (GRCm39) missense probably benign 0.00
R9697:Adamts19 UTSW 18 59,101,834 (GRCm39) missense probably damaging 0.99
R9747:Adamts19 UTSW 18 59,023,487 (GRCm39) missense possibly damaging 0.69
Z1177:Adamts19 UTSW 18 59,023,446 (GRCm39) missense possibly damaging 0.47
Z1177:Adamts19 UTSW 18 58,971,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCACCGAGTTCTGCCC -3'
(R):5'- GGTTGTTATATGCCAGTGAGGTCAGAAA -3'

Sequencing Primer
(F):5'- TAAGCCTATAAATGCCCTGCTC -3'
(R):5'- CCAGTGAGGTCAGAAAAAAAAAATG -3'
Posted On 2014-04-13