Incidental Mutation 'R1539:Ttc28'
ID171543
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
MMRRC Submission 039578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1539 (G1)
Quality Score189
Status Not validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111100811 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 210 (V210A)
Ref Sequence ENSEMBL: ENSMUSP00000137609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040111
AA Change: V210A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: V210A

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156290
AA Change: V210A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: V210A

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T A 17: 23,717,144 probably benign Het
Adgrv1 T A 13: 81,503,978 probably null Het
Adh7 A C 3: 138,223,955 T131P possibly damaging Het
Agxt G A 1: 93,137,979 G190D probably damaging Het
AI182371 A G 2: 35,088,803 I193T probably damaging Het
Akna T A 4: 63,379,310 T836S probably benign Het
Alox12 T C 11: 70,253,243 probably null Het
Anapc2 C A 2: 25,273,063 T104K probably benign Het
Ank1 T C 8: 23,093,919 L346P probably damaging Het
Ankfn1 A T 11: 89,441,391 I443N probably damaging Het
Arhgef17 G A 7: 100,890,473 T1066I probably damaging Het
Atg2a C A 19: 6,246,771 probably null Het
Atp5s G A 12: 69,741,071 D94N probably benign Het
Bpifb5 T A 2: 154,223,856 H24Q probably benign Het
Brd9 A G 13: 73,944,743 E283G probably damaging Het
Cadm2 C A 16: 66,784,840 V184F probably damaging Het
Casr A G 16: 36,495,137 V857A probably benign Het
Ccdc18 A T 5: 108,191,977 Q796L probably damaging Het
Cep290 T C 10: 100,496,828 V263A probably benign Het
Clec10a A T 11: 70,169,819 N167Y probably damaging Het
Cog1 A G 11: 113,652,232 I189V possibly damaging Het
Commd2 A G 3: 57,646,848 I144T probably benign Het
Cse1l A G 2: 166,926,372 T197A probably benign Het
Csmd3 A T 15: 47,820,398 S1783R probably benign Het
Cxxc1 T C 18: 74,219,207 V334A possibly damaging Het
Dennd2d A G 3: 106,486,920 I39V probably benign Het
Dgkz G A 2: 91,938,060 P734S probably damaging Het
Diaph3 T C 14: 86,656,480 D31G probably damaging Het
Dlec1 T C 9: 119,127,450 S731P probably benign Het
Dnah11 T C 12: 117,931,256 R3619G probably benign Het
Doc2b A G 11: 75,771,957 L405P probably damaging Het
Dock3 A T 9: 106,952,364 I1117N probably damaging Het
Dock3 G A 9: 106,996,913 A453V probably benign Het
Ece2 T A 16: 20,642,513 I474N probably damaging Het
Etv4 A T 11: 101,771,687 probably null Het
Fam171b A T 2: 83,880,098 M705L probably benign Het
Frem2 T C 3: 53,654,210 K959E probably benign Het
Fyn T C 10: 39,532,070 M251T possibly damaging Het
Galnt13 G A 2: 54,857,857 G250E probably damaging Het
Ggh T C 4: 20,054,204 probably null Het
Glcci1 A G 6: 8,591,620 E222G probably damaging Het
Gm1968 G A 16: 29,958,841 noncoding transcript Het
Gm3604 T A 13: 62,371,600 I52F possibly damaging Het
Gm43302 T C 5: 105,274,769 I466V probably benign Het
Gm9789 T C 16: 89,158,146 S48P unknown Het
Gpat3 A T 5: 100,883,388 Y136F probably benign Het
Gpr171 T C 3: 59,097,721 D211G possibly damaging Het
Hs3st1 T C 5: 39,614,448 K284R probably benign Het
Htr2a C T 14: 74,645,168 A198V possibly damaging Het
Ice1 C A 13: 70,605,904 D688Y probably damaging Het
Jade1 T C 3: 41,604,996 M504T probably benign Het
Lrp1 T C 10: 127,584,381 probably null Het
Lsr A T 7: 30,972,092 I72N possibly damaging Het
Magel2 G A 7: 62,378,809 R487H possibly damaging Het
Mertk A G 2: 128,782,526 D619G probably benign Het
Myo1b A T 1: 51,799,563 V245E probably damaging Het
Myrip T A 9: 120,424,623 L254Q probably benign Het
Nav3 A G 10: 109,767,170 S1173P probably damaging Het
Ncoa7 T C 10: 30,771,729 Y17C probably damaging Het
Ncor2 T C 5: 125,109,939 E7G probably benign Het
Ninl A G 2: 150,975,947 V99A probably damaging Het
Noct G T 3: 51,247,912 E34* probably null Het
Notch1 A T 2: 26,472,113 Y1043* probably null Het
Olfr1420 T C 19: 11,896,491 S157P possibly damaging Het
Olfr532 T A 7: 140,419,413 Y120F probably benign Het
Olfr707 A G 7: 106,891,276 Y278H probably damaging Het
Olfr794 G A 10: 129,570,771 G39R probably damaging Het
Pde7b C A 10: 20,479,686 R104L possibly damaging Het
Pkn1 C A 8: 83,670,337 R890L possibly damaging Het
Podn A T 4: 108,021,567 Y368N probably damaging Het
Polr1b G A 2: 129,118,099 probably null Het
Ppp1r3c A T 19: 36,733,961 F136L probably benign Het
Ppp2ca T A 11: 52,120,973 F260Y probably damaging Het
Prss39 A G 1: 34,498,535 S27G possibly damaging Het
Ptch1 A G 13: 63,541,287 V340A probably benign Het
Ranbp17 T C 11: 33,297,394 I246V probably damaging Het
Rilpl1 T A 5: 124,515,555 D181V probably damaging Het
Sdk1 T A 5: 142,094,599 V1282D probably damaging Het
Sh3rf2 T C 18: 42,149,822 S514P probably damaging Het
Slc35f2 A T 9: 53,809,708 I252F possibly damaging Het
Slc7a1 A G 5: 148,335,593 Y425H possibly damaging Het
Spaca4 G T 7: 45,725,560 probably benign Het
Spata31d1b T C 13: 59,715,919 S294P possibly damaging Het
Ssh1 T G 5: 113,952,003 T342P probably damaging Het
Stk10 T A 11: 32,533,440 S13T possibly damaging Het
Tbx1 G T 16: 18,584,093 D214E probably benign Het
Tdp1 A G 12: 99,912,312 E453G probably damaging Het
Tlr1 T C 5: 64,926,976 Y86C probably damaging Het
Tmem241 A T 18: 12,043,240 C124S possibly damaging Het
Trp63 A G 16: 25,884,849 M516V probably benign Het
Tut1 C T 19: 8,965,486 R646W probably benign Het
Ubald1 C T 16: 4,876,397 E49K possibly damaging Het
Usp28 T C 9: 49,037,796 Y897H probably benign Het
Vmn2r27 A C 6: 124,191,771 F800C probably damaging Het
Vmn2r83 T A 10: 79,491,925 M789K probably damaging Het
Vwa8 A G 14: 79,062,562 D945G probably benign Het
Wdhd1 T A 14: 47,245,050 K947N possibly damaging Het
Wdr12 A T 1: 60,083,848 probably null Het
Xrra1 A T 7: 99,871,357 E57V probably damaging Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
R7350:Ttc28 UTSW 5 111226037 missense probably damaging 0.97
R7454:Ttc28 UTSW 5 111285484 missense probably benign 0.19
R7461:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7596:Ttc28 UTSW 5 111280124 missense probably damaging 1.00
R7613:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7625:Ttc28 UTSW 5 111285219 missense possibly damaging 0.65
R7648:Ttc28 UTSW 5 111183392 missense possibly damaging 0.52
R7735:Ttc28 UTSW 5 111266678 splice site probably null
R8030:Ttc28 UTSW 5 111286056 missense possibly damaging 0.81
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Z1176:Ttc28 UTSW 5 111266566 missense possibly damaging 0.59
Z1177:Ttc28 UTSW 5 111278586 missense probably damaging 1.00
Z1177:Ttc28 UTSW 5 111285739 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAAGGAAAGACCGCTGTGCCTAC -3'
(R):5'- TGAAGTTGAGTCACCCACAGACCC -3'

Sequencing Primer
(F):5'- ACCGCTGTGCCTACCAATC -3'
(R):5'- GGCCCTGAAGCTAAATGTTC -3'
Posted On2014-04-13