Incidental Mutation 'R1539:Nav3'
ID171575
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 039578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1539 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109767170 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1173 (S1173P)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: S1173P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: S1173P

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163071
SMART Domains Protein: ENSMUSP00000124856
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 140 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T A 17: 23,717,144 probably benign Het
Adgrv1 T A 13: 81,503,978 probably null Het
Adh7 A C 3: 138,223,955 T131P possibly damaging Het
Agxt G A 1: 93,137,979 G190D probably damaging Het
AI182371 A G 2: 35,088,803 I193T probably damaging Het
Akna T A 4: 63,379,310 T836S probably benign Het
Alox12 T C 11: 70,253,243 probably null Het
Anapc2 C A 2: 25,273,063 T104K probably benign Het
Ank1 T C 8: 23,093,919 L346P probably damaging Het
Ankfn1 A T 11: 89,441,391 I443N probably damaging Het
Arhgef17 G A 7: 100,890,473 T1066I probably damaging Het
Atg2a C A 19: 6,246,771 probably null Het
Atp5s G A 12: 69,741,071 D94N probably benign Het
Bpifb5 T A 2: 154,223,856 H24Q probably benign Het
Brd9 A G 13: 73,944,743 E283G probably damaging Het
Cadm2 C A 16: 66,784,840 V184F probably damaging Het
Casr A G 16: 36,495,137 V857A probably benign Het
Ccdc18 A T 5: 108,191,977 Q796L probably damaging Het
Cep290 T C 10: 100,496,828 V263A probably benign Het
Clec10a A T 11: 70,169,819 N167Y probably damaging Het
Cog1 A G 11: 113,652,232 I189V possibly damaging Het
Commd2 A G 3: 57,646,848 I144T probably benign Het
Cse1l A G 2: 166,926,372 T197A probably benign Het
Csmd3 A T 15: 47,820,398 S1783R probably benign Het
Cxxc1 T C 18: 74,219,207 V334A possibly damaging Het
Dennd2d A G 3: 106,486,920 I39V probably benign Het
Dgkz G A 2: 91,938,060 P734S probably damaging Het
Diaph3 T C 14: 86,656,480 D31G probably damaging Het
Dlec1 T C 9: 119,127,450 S731P probably benign Het
Dnah11 T C 12: 117,931,256 R3619G probably benign Het
Doc2b A G 11: 75,771,957 L405P probably damaging Het
Dock3 A T 9: 106,952,364 I1117N probably damaging Het
Dock3 G A 9: 106,996,913 A453V probably benign Het
Ece2 T A 16: 20,642,513 I474N probably damaging Het
Etv4 A T 11: 101,771,687 probably null Het
Fam171b A T 2: 83,880,098 M705L probably benign Het
Frem2 T C 3: 53,654,210 K959E probably benign Het
Fyn T C 10: 39,532,070 M251T possibly damaging Het
Galnt13 G A 2: 54,857,857 G250E probably damaging Het
Ggh T C 4: 20,054,204 probably null Het
Glcci1 A G 6: 8,591,620 E222G probably damaging Het
Gm1968 G A 16: 29,958,841 noncoding transcript Het
Gm3604 T A 13: 62,371,600 I52F possibly damaging Het
Gm43302 T C 5: 105,274,769 I466V probably benign Het
Gm9789 T C 16: 89,158,146 S48P unknown Het
Gpat3 A T 5: 100,883,388 Y136F probably benign Het
Gpr171 T C 3: 59,097,721 D211G possibly damaging Het
Hs3st1 T C 5: 39,614,448 K284R probably benign Het
Htr2a C T 14: 74,645,168 A198V possibly damaging Het
Ice1 C A 13: 70,605,904 D688Y probably damaging Het
Jade1 T C 3: 41,604,996 M504T probably benign Het
Lrp1 T C 10: 127,584,381 probably null Het
Lsr A T 7: 30,972,092 I72N possibly damaging Het
Magel2 G A 7: 62,378,809 R487H possibly damaging Het
Mertk A G 2: 128,782,526 D619G probably benign Het
Myo1b A T 1: 51,799,563 V245E probably damaging Het
Myrip T A 9: 120,424,623 L254Q probably benign Het
Ncoa7 T C 10: 30,771,729 Y17C probably damaging Het
Ncor2 T C 5: 125,109,939 E7G probably benign Het
Ninl A G 2: 150,975,947 V99A probably damaging Het
Noct G T 3: 51,247,912 E34* probably null Het
Notch1 A T 2: 26,472,113 Y1043* probably null Het
Olfr1420 T C 19: 11,896,491 S157P possibly damaging Het
Olfr532 T A 7: 140,419,413 Y120F probably benign Het
Olfr707 A G 7: 106,891,276 Y278H probably damaging Het
Olfr794 G A 10: 129,570,771 G39R probably damaging Het
Pde7b C A 10: 20,479,686 R104L possibly damaging Het
Pkn1 C A 8: 83,670,337 R890L possibly damaging Het
Podn A T 4: 108,021,567 Y368N probably damaging Het
Polr1b G A 2: 129,118,099 probably null Het
Ppp1r3c A T 19: 36,733,961 F136L probably benign Het
Ppp2ca T A 11: 52,120,973 F260Y probably damaging Het
Prss39 A G 1: 34,498,535 S27G possibly damaging Het
Ptch1 A G 13: 63,541,287 V340A probably benign Het
Ranbp17 T C 11: 33,297,394 I246V probably damaging Het
Rilpl1 T A 5: 124,515,555 D181V probably damaging Het
Sdk1 T A 5: 142,094,599 V1282D probably damaging Het
Sh3rf2 T C 18: 42,149,822 S514P probably damaging Het
Slc35f2 A T 9: 53,809,708 I252F possibly damaging Het
Slc7a1 A G 5: 148,335,593 Y425H possibly damaging Het
Spaca4 G T 7: 45,725,560 probably benign Het
Spata31d1b T C 13: 59,715,919 S294P possibly damaging Het
Ssh1 T G 5: 113,952,003 T342P probably damaging Het
Stk10 T A 11: 32,533,440 S13T possibly damaging Het
Tbx1 G T 16: 18,584,093 D214E probably benign Het
Tdp1 A G 12: 99,912,312 E453G probably damaging Het
Tlr1 T C 5: 64,926,976 Y86C probably damaging Het
Tmem241 A T 18: 12,043,240 C124S possibly damaging Het
Trp63 A G 16: 25,884,849 M516V probably benign Het
Ttc28 T C 5: 111,100,811 V210A possibly damaging Het
Tut1 C T 19: 8,965,486 R646W probably benign Het
Ubald1 C T 16: 4,876,397 E49K possibly damaging Het
Usp28 T C 9: 49,037,796 Y897H probably benign Het
Vmn2r27 A C 6: 124,191,771 F800C probably damaging Het
Vmn2r83 T A 10: 79,491,925 M789K probably damaging Het
Vwa8 A G 14: 79,062,562 D945G probably benign Het
Wdhd1 T A 14: 47,245,050 K947N possibly damaging Het
Wdr12 A T 1: 60,083,848 probably null Het
Xrra1 A T 7: 99,871,357 E57V probably damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAAATGTGGGCGAGGCAATATC -3'
(R):5'- TTGGTGGGAAGTCCAATGCAGG -3'

Sequencing Primer
(F):5'- TTGAGTCCCACAGGCACTG -3'
(R):5'- TCCAATGCAGGAAGGAAAACC -3'
Posted On2014-04-13