Mutagenetix > Incidental Mutations

Incidental Mutation 'R1540:Ptgfrn'

171640

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

039579-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1540 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101060654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 541 (I541T)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably benign
Transcript: ENSMUST00000102694
AA Change: I541T

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: I541T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198037

Meta Mutation Damage Score

0.1666

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

96% (72/75)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	G	3: 116,780,735	C767R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Ap3d1	A	T	10: 80,715,941	I644N	probably benign	Het
Asb16	A	G	11: 102,272,576	I131V	probably benign	Het
Atp6v0a2	C	A	5: 124,646,698	A307D	probably damaging	Het
C1qtnf1	C	T	11: 118,447,923	H140Y	probably benign	Het
Cacna1g	T	A	11: 94,457,039	D741V	probably damaging	Het
Caprin2	T	A	6: 148,876,471	T211S	probably benign	Het
Carmil1	T	C	13: 24,099,054	E89G	possibly damaging	Het
Casz1	T	A	4: 148,942,900		probably benign	Het
Catsperb	G	A	12: 101,412,330	R30Q	probably benign	Het
Ccdc102a	A	T	8: 94,907,713		probably null	Het
Ccdc110	G	T	8: 45,942,325	E418*	probably null	Het
Ccdc90b	C	T	7: 92,581,816	A210V	probably benign	Het
Cdadc1	G	T	14: 59,586,083	A320E	probably damaging	Het
Cdadc1	T	A	14: 59,586,092	Q317L	probably damaging	Het
Cep170	C	A	1: 176,739,932	W1396L	probably damaging	Het
Col4a6	T	C	X: 141,227,858	T129A	probably damaging	Het
Ctcfl	C	T	2: 173,112,348	D319N	probably benign	Het
Dclk1	T	C	3: 55,477,823	S45P	probably damaging	Het
Efcab3	T	C	11: 105,108,900	I5581T	probably benign	Het
Evi2	T	C	11: 79,515,586	I388V	probably benign	Het
Fbxl5	A	T	5: 43,758,636	V435E	possibly damaging	Het
Fig4	A	T	10: 41,188,586	M887K	possibly damaging	Het
Glt8d1	G	A	14: 31,011,592	V345I	probably benign	Het
Gm5709	T	C	3: 59,618,652		noncoding transcript	Het
Hsp90b1	A	G	10: 86,694,042	F264L	probably damaging	Het
Id3	A	G	4: 136,143,939	S21G	possibly damaging	Het
Ighe	T	A	12: 113,271,446	N365Y	unknown	Het
Il17rd	T	G	14: 27,099,958	M403R	probably damaging	Het
Ints10	A	G	8: 68,796,713		probably benign	Het
Kcnc4	T	A	3: 107,445,427		probably null	Het
Kctd19	A	G	8: 105,387,879	S517P	probably damaging	Het
Lama5	A	G	2: 180,180,151	F2964L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,990	K405R	probably benign	Het
Lyst	T	A	13: 13,635,101	M452K	possibly damaging	Het
Mroh7	A	G	4: 106,703,076	L677P	probably benign	Het
Mrps27	T	A	13: 99,405,050	F221I	probably benign	Het
Nhlrc1	C	T	13: 47,014,344	V146M	probably damaging	Het
Nlrp9b	T	A	7: 20,048,847	C895*	probably null	Het
Nod1	T	C	6: 54,943,975	T453A	probably benign	Het
Nodal	T	C	10: 61,422,985	V67A	probably damaging	Het
Ntsr1	T	C	2: 180,542,647	L381P	probably damaging	Het
Olfr1360	T	A	13: 21,674,530	Q138L	probably benign	Het
Olfr272	T	C	4: 52,910,996	D266G	probably benign	Het
Olfr311	T	A	11: 58,841,651	M179K	probably benign	Het
P2ry14	T	A	3: 59,115,265	K267M	probably benign	Het
Pcdh1	T	C	18: 38,189,726	N1018S	probably benign	Het
Pkn3	G	A	2: 30,084,691	V406I	probably damaging	Het
Prkcb	C	T	7: 122,627,693	T634I	probably damaging	Het
Psme2b	T	A	11: 48,945,382		probably null	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapb	T	C	2: 158,465,826	V684A	probably benign	Het
Rbbp5	C	T	1: 132,494,282	R307*	probably null	Het
Rcor1	T	A	12: 111,103,603		probably benign	Het
Rlbp1	C	T	7: 79,380,060	A142T	probably damaging	Het
Rps6ka2	A	G	17: 7,292,906	E581G	probably null	Het
Sars	A	T	3: 108,433,145	V155E	probably benign	Het
Sec31a	G	C	5: 100,375,319	P569A	probably damaging	Het
Selenof	A	T	3: 144,594,924	K111*	probably null	Het
Serpinb7	C	T	1: 107,428,268	A7V	possibly damaging	Het
Smc4	T	A	3: 69,016,772	Y298N	probably damaging	Het
Snrpa1	T	A	7: 66,070,661	I204N	probably damaging	Het
Spry4	T	G	18: 38,601,687		probably benign	Het
Tcea2	A	G	2: 181,686,958	N261S	possibly damaging	Het
Tmem59l	A	G	8: 70,485,154	F192S	probably benign	Het
Tnr	T	A	1: 159,850,105	I20N	probably damaging	Het
Ttll5	C	T	12: 85,892,208	Q427*	probably null	Het
Vps45	C	T	3: 96,048,346	A111T	probably damaging	Het
Zfp395	T	C	14: 65,393,074	S358P	probably benign	Het
Zfp438	A	G	18: 5,210,740	V766A	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGGTTCCAGTTCCCTAGTGTATGA -3'
(R):5'- ACCAGGTCTACCTGAACGCTTCTAA -3'

Sequencing Primer
(F):5'- CAGTTCCCTAGTGTATGAGCACAG -3'
(R):5'- GGTACTATAGAATGACCCGTCGC -3'

Posted On

2014-04-13