Incidental Mutation 'R1540:Mroh7'
ID171646
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Namemaestro heat-like repeat family member 7
SynonymsHeatr8, LOC381538, Gm1027
MMRRC Submission 039579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1540 (G1)
Quality Score208
Status Validated
Chromosome4
Chromosomal Location106680417-106730925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106703076 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 677 (L677P)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770]
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: L677P

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: L677P

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Meta Mutation Damage Score 0.3767 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Caprin2 T A 6: 148,876,471 T211S probably benign Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Casz1 T A 4: 148,942,900 probably benign Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fbxl5 A T 5: 43,758,636 V435E possibly damaging Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp395 T C 14: 65,393,074 S358P probably benign Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106703161 missense probably benign 0.00
IGL01729:Mroh7 APN 4 106704205 missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106680874 missense probably benign 0.00
IGL02003:Mroh7 APN 4 106702529 missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106702510 missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106707782 missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106720591 missense probably benign 0.04
IGL02896:Mroh7 APN 4 106699816 missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106692398 missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106714091 nonsense probably null
holy UTSW 4 106709955 splice site probably null
moley UTSW 4 106694312 splice site probably null
P0016:Mroh7 UTSW 4 106707857 critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106721426 missense probably benign 0.07
R0094:Mroh7 UTSW 4 106703184 missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106691664 missense probably benign 0.01
R0828:Mroh7 UTSW 4 106699876 missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106680793 missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106707594 unclassified probably null
R1301:Mroh7 UTSW 4 106720495 missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106695141 splice site probably benign
R1491:Mroh7 UTSW 4 106703058 missense probably benign 0.11
R1560:Mroh7 UTSW 4 106711254 missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106720668 missense probably benign 0.19
R1804:Mroh7 UTSW 4 106694392 missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106700181 missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106720927 missense probably benign 0.01
R2866:Mroh7 UTSW 4 106691090 missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R3718:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R4530:Mroh7 UTSW 4 106720437 missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106691513 critical splice donor site probably null
R4706:Mroh7 UTSW 4 106691624 missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106709955 splice site probably null
R4965:Mroh7 UTSW 4 106690987 missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106680873 missense probably benign
R4971:Mroh7 UTSW 4 106691552 missense probably benign 0.04
R5083:Mroh7 UTSW 4 106690318 missense probably benign 0.03
R5207:Mroh7 UTSW 4 106721386 missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106691643 missense probably benign 0.10
R5392:Mroh7 UTSW 4 106711251 critical splice donor site probably null
R5630:Mroh7 UTSW 4 106720567 missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106702618 missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106708560 missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106681885 missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106694312 splice site probably null
R5979:Mroh7 UTSW 4 106720926 missense probably benign 0.00
R6479:Mroh7 UTSW 4 106703188 missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106721263 missense probably benign 0.00
R6657:Mroh7 UTSW 4 106702500 nonsense probably null
R6732:Mroh7 UTSW 4 106680713 frame shift probably null
R6817:Mroh7 UTSW 4 106714115 missense probably benign 0.00
R6980:Mroh7 UTSW 4 106700237 missense probably benign 0.05
R7062:Mroh7 UTSW 4 106683980 missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106711320 missense probably benign 0.07
R7134:Mroh7 UTSW 4 106720594 missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106691639 missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106683918 missense probably benign
R7516:Mroh7 UTSW 4 106691119 missense probably benign 0.00
R7525:Mroh7 UTSW 4 106709702 missense probably benign 0.22
R7540:Mroh7 UTSW 4 106720398 missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106721090 missense probably benign
R7932:Mroh7 UTSW 4 106721090 missense probably benign
R7998:Mroh7 UTSW 4 106711281 missense probably benign 0.02
R8026:Mroh7 UTSW 4 106721437 missense probably benign 0.01
R8122:Mroh7 UTSW 4 106702529 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGTACATATGCCTTCCTAGCCCAC -3'
(R):5'- CATAATCTTCAGCCTCCCAGGCAG -3'

Sequencing Primer
(F):5'- GCCCACTGCTCAGTTCCAG -3'
(R):5'- ACTGACCTTCTCCGTGAATTAGG -3'
Posted On2014-04-13