Incidental Mutation 'R1540:Mroh7'
ID 171646
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Name maestro heat-like repeat family member 7
Synonyms Heatr8, Gm1027, LOC381538
MMRRC Submission 039579-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1540 (G1)
Quality Score 208
Status Validated
Chromosome 4
Chromosomal Location 106537614-106588122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106560273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 677 (L677P)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770]
AlphaFold A2AVR2
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: L677P

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: L677P

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Meta Mutation Damage Score 0.3767 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,574,384 (GRCm39) C767R probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Ap3d1 A T 10: 80,551,775 (GRCm39) I644N probably benign Het
Asb16 A G 11: 102,163,402 (GRCm39) I131V probably benign Het
Atp6v0a2 C A 5: 124,784,638 (GRCm39) A307D probably damaging Het
C1qtnf1 C T 11: 118,338,749 (GRCm39) H140Y probably benign Het
Cacna1g T A 11: 94,347,865 (GRCm39) D741V probably damaging Het
Caprin2 T A 6: 148,777,969 (GRCm39) T211S probably benign Het
Carmil1 T C 13: 24,283,037 (GRCm39) E89G possibly damaging Het
Casz1 T A 4: 149,027,357 (GRCm39) probably benign Het
Catsperb G A 12: 101,378,589 (GRCm39) R30Q probably benign Het
Ccdc102a A T 8: 95,634,341 (GRCm39) probably null Het
Ccdc110 G T 8: 46,395,362 (GRCm39) E418* probably null Het
Ccdc90b C T 7: 92,231,024 (GRCm39) A210V probably benign Het
Cdadc1 G T 14: 59,823,532 (GRCm39) A320E probably damaging Het
Cdadc1 T A 14: 59,823,541 (GRCm39) Q317L probably damaging Het
Cep170 C A 1: 176,567,498 (GRCm39) W1396L probably damaging Het
Col4a6 T C X: 140,010,854 (GRCm39) T129A probably damaging Het
Ctcfl C T 2: 172,954,141 (GRCm39) D319N probably benign Het
Dclk1 T C 3: 55,385,244 (GRCm39) S45P probably damaging Het
Efcab3 T C 11: 104,999,726 (GRCm39) I5581T probably benign Het
Evi2 T C 11: 79,406,412 (GRCm39) I388V probably benign Het
Fbxl5 A T 5: 43,915,978 (GRCm39) V435E possibly damaging Het
Fig4 A T 10: 41,064,582 (GRCm39) M887K possibly damaging Het
Glt8d1 G A 14: 30,733,549 (GRCm39) V345I probably benign Het
Gm5709 T C 3: 59,526,073 (GRCm39) noncoding transcript Het
Hsp90b1 A G 10: 86,529,906 (GRCm39) F264L probably damaging Het
Id3 A G 4: 135,871,250 (GRCm39) S21G possibly damaging Het
Ighe T A 12: 113,235,066 (GRCm39) N365Y unknown Het
Il17rd T G 14: 26,821,915 (GRCm39) M403R probably damaging Het
Ints10 A G 8: 69,249,365 (GRCm39) probably benign Het
Kcnc4 T A 3: 107,352,743 (GRCm39) probably null Het
Kctd19 A G 8: 106,114,511 (GRCm39) S517P probably damaging Het
Lama5 A G 2: 179,821,944 (GRCm39) F2964L probably benign Het
Lin54 A T 5: 100,628,109 (GRCm39) N31K probably damaging Het
Lrrc8e A G 8: 4,284,990 (GRCm39) K405R probably benign Het
Lyst T A 13: 13,809,686 (GRCm39) M452K possibly damaging Het
Mrps27 T A 13: 99,541,558 (GRCm39) F221I probably benign Het
Nhlrc1 C T 13: 47,167,820 (GRCm39) V146M probably damaging Het
Nlrp9b T A 7: 19,782,772 (GRCm39) C895* probably null Het
Nod1 T C 6: 54,920,960 (GRCm39) T453A probably benign Het
Nodal T C 10: 61,258,764 (GRCm39) V67A probably damaging Het
Ntsr1 T C 2: 180,184,440 (GRCm39) L381P probably damaging Het
Or13c25 T C 4: 52,910,996 (GRCm39) D266G probably benign Het
Or2b2b T A 13: 21,858,700 (GRCm39) Q138L probably benign Het
Or9e1 T A 11: 58,732,477 (GRCm39) M179K probably benign Het
P2ry14 T A 3: 59,022,686 (GRCm39) K267M probably benign Het
Pcdh1 T C 18: 38,322,779 (GRCm39) N1018S probably benign Het
Pkn3 G A 2: 29,974,703 (GRCm39) V406I probably damaging Het
Prkcb C T 7: 122,226,916 (GRCm39) T634I probably damaging Het
Psme2b T A 11: 48,836,209 (GRCm39) probably null Het
Ptgfrn A G 3: 100,967,970 (GRCm39) I541T probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ralgapb T C 2: 158,307,746 (GRCm39) V684A probably benign Het
Rbbp5 C T 1: 132,422,020 (GRCm39) R307* probably null Het
Rcor1 T A 12: 111,070,037 (GRCm39) probably benign Het
Rlbp1 C T 7: 79,029,808 (GRCm39) A142T probably damaging Het
Rps6ka2 A G 17: 7,560,305 (GRCm39) E581G probably null Het
Sars1 A T 3: 108,340,461 (GRCm39) V155E probably benign Het
Sec31a G C 5: 100,523,178 (GRCm39) P569A probably damaging Het
Selenof A T 3: 144,300,685 (GRCm39) K111* probably null Het
Serpinb7 C T 1: 107,355,998 (GRCm39) A7V possibly damaging Het
Smc4 T A 3: 68,924,105 (GRCm39) Y298N probably damaging Het
Snrpa1 T A 7: 65,720,409 (GRCm39) I204N probably damaging Het
Spry4 T G 18: 38,734,740 (GRCm39) probably benign Het
Tcea2 A G 2: 181,328,751 (GRCm39) N261S possibly damaging Het
Tmem59l A G 8: 70,937,804 (GRCm39) F192S probably benign Het
Tnr T A 1: 159,677,675 (GRCm39) I20N probably damaging Het
Ttll5 C T 12: 85,938,982 (GRCm39) Q427* probably null Het
Vps45 C T 3: 95,955,658 (GRCm39) A111T probably damaging Het
Zfp395 T C 14: 65,630,523 (GRCm39) S358P probably benign Het
Zfp438 A G 18: 5,210,740 (GRCm39) V766A probably benign Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106,560,358 (GRCm39) missense probably benign 0.00
IGL01729:Mroh7 APN 4 106,561,402 (GRCm39) missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106,538,071 (GRCm39) missense probably benign 0.00
IGL02003:Mroh7 APN 4 106,559,726 (GRCm39) missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106,559,707 (GRCm39) missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106,564,979 (GRCm39) missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106,577,788 (GRCm39) missense probably benign 0.04
IGL02896:Mroh7 APN 4 106,557,013 (GRCm39) missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106,549,595 (GRCm39) missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106,571,288 (GRCm39) nonsense probably null
holy UTSW 4 106,567,152 (GRCm39) splice site probably null
moley UTSW 4 106,551,509 (GRCm39) splice site probably null
P0016:Mroh7 UTSW 4 106,565,054 (GRCm39) critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106,578,623 (GRCm39) missense probably benign 0.07
R0094:Mroh7 UTSW 4 106,560,381 (GRCm39) missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106,548,861 (GRCm39) missense probably benign 0.01
R0828:Mroh7 UTSW 4 106,557,073 (GRCm39) missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106,537,990 (GRCm39) missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106,564,791 (GRCm39) splice site probably null
R1301:Mroh7 UTSW 4 106,577,692 (GRCm39) missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106,552,338 (GRCm39) splice site probably benign
R1491:Mroh7 UTSW 4 106,560,255 (GRCm39) missense probably benign 0.11
R1560:Mroh7 UTSW 4 106,568,451 (GRCm39) missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106,577,865 (GRCm39) missense probably benign 0.19
R1804:Mroh7 UTSW 4 106,551,589 (GRCm39) missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106,557,378 (GRCm39) missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106,578,124 (GRCm39) missense probably benign 0.01
R2866:Mroh7 UTSW 4 106,548,287 (GRCm39) missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R3718:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R4530:Mroh7 UTSW 4 106,577,634 (GRCm39) missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106,548,710 (GRCm39) critical splice donor site probably null
R4706:Mroh7 UTSW 4 106,548,821 (GRCm39) missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106,567,152 (GRCm39) splice site probably null
R4965:Mroh7 UTSW 4 106,548,184 (GRCm39) missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106,538,070 (GRCm39) missense probably benign
R4971:Mroh7 UTSW 4 106,548,749 (GRCm39) missense probably benign 0.04
R5083:Mroh7 UTSW 4 106,547,515 (GRCm39) missense probably benign 0.03
R5207:Mroh7 UTSW 4 106,578,583 (GRCm39) missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106,548,840 (GRCm39) missense probably benign 0.10
R5392:Mroh7 UTSW 4 106,568,448 (GRCm39) critical splice donor site probably null
R5630:Mroh7 UTSW 4 106,577,764 (GRCm39) missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106,559,815 (GRCm39) missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106,565,757 (GRCm39) missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106,539,082 (GRCm39) missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106,551,509 (GRCm39) splice site probably null
R5979:Mroh7 UTSW 4 106,578,123 (GRCm39) missense probably benign 0.00
R6479:Mroh7 UTSW 4 106,560,385 (GRCm39) missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106,578,460 (GRCm39) missense probably benign 0.00
R6657:Mroh7 UTSW 4 106,559,697 (GRCm39) nonsense probably null
R6732:Mroh7 UTSW 4 106,537,910 (GRCm39) frame shift probably null
R6817:Mroh7 UTSW 4 106,571,312 (GRCm39) missense probably benign 0.00
R6980:Mroh7 UTSW 4 106,557,434 (GRCm39) missense probably benign 0.05
R7062:Mroh7 UTSW 4 106,541,177 (GRCm39) missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106,568,517 (GRCm39) missense probably benign 0.07
R7134:Mroh7 UTSW 4 106,577,791 (GRCm39) missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106,548,836 (GRCm39) missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106,541,115 (GRCm39) missense probably benign
R7516:Mroh7 UTSW 4 106,548,316 (GRCm39) missense probably benign 0.00
R7525:Mroh7 UTSW 4 106,566,899 (GRCm39) missense probably benign 0.22
R7540:Mroh7 UTSW 4 106,577,595 (GRCm39) missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106,578,287 (GRCm39) missense probably benign
R7920:Mroh7 UTSW 4 106,564,773 (GRCm39) missense probably benign
R7998:Mroh7 UTSW 4 106,568,478 (GRCm39) missense probably benign 0.02
R8026:Mroh7 UTSW 4 106,578,634 (GRCm39) missense probably benign 0.01
R8122:Mroh7 UTSW 4 106,559,726 (GRCm39) missense probably damaging 0.96
R8249:Mroh7 UTSW 4 106,578,409 (GRCm39) missense probably benign 0.00
R9188:Mroh7 UTSW 4 106,566,789 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTACATATGCCTTCCTAGCCCAC -3'
(R):5'- CATAATCTTCAGCCTCCCAGGCAG -3'

Sequencing Primer
(F):5'- GCCCACTGCTCAGTTCCAG -3'
(R):5'- ACTGACCTTCTCCGTGAATTAGG -3'
Posted On 2014-04-13