Incidental Mutation 'R1540:Fbxl5'
ID171650
Institutional Source Beutler Lab
Gene Symbol Fbxl5
Ensembl Gene ENSMUSG00000039753
Gene NameF-box and leucine-rich repeat protein 5
SynonymsFbl4, Fir4
MMRRC Submission 039579-MU
Accession Numbers

Genbank: NM_001159963.1, NM_178729.4; Ensemble: ENSMUST00000114047, ENSMUST00000114047, ENSMUST00000119523, ENSMUST00000141902, ENSMUST00000087465, ENSMUST00000121736, ENSMUST00000124610                                     

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1540 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43744615-43821638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43758636 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 435 (V435E)
Ref Sequence ENSEMBL: ENSMUSP00000112444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000087465] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000121736] [ENSMUST00000124610] [ENSMUST00000196483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047857
AA Change: V478E

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753
AA Change: V478E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000087465
AA Change: V478E

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084733
Gene: ENSMUSG00000039753
AA Change: V478E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 4.3e-15 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1.23e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114047
AA Change: V472E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753
AA Change: V472E

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000119523
AA Change: V461E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753
AA Change: V461E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000121736
AA Change: V435E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112444
Gene: ENSMUSG00000039753
AA Change: V435E

DomainStartEndE-ValueType
PDB:3V5Z|B 1 118 2e-71 PDB
FBOX 165 205 2.31e-9 SMART
low complexity region 246 267 N/A INTRINSIC
LRR 312 336 2.43e2 SMART
LRR 339 364 4.87e-4 SMART
low complexity region 438 449 N/A INTRINSIC
LRR 553 578 1.23e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124421
Predicted Effect possibly damaging
Transcript: ENSMUST00000124610
AA Change: V478E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116720
Gene: ENSMUSG00000039753
AA Change: V478E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 5.7e-12 PFAM
FBOX 208 248 1.5e-11 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 1e0 SMART
LRR 382 407 2e-6 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1e-2 SMART
LRR 624 649 1.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140469
Predicted Effect unknown
Transcript: ENSMUST00000141902
AA Change: V398E
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753
AA Change: V398E

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143316
Predicted Effect possibly damaging
Transcript: ENSMUST00000196483
AA Change: V477E

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753
AA Change: V477E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196543
Meta Mutation Damage Score 0.5814 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before turning of the embryo with iron overload, growth retardation, and hemorrhage. Mice heterozygous for a knock-out allele exhibit abnormal iron homeostasis when fed a low iron diet. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Caprin2 T A 6: 148,876,471 T211S probably benign Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Casz1 T A 4: 148,942,900 probably benign Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mroh7 A G 4: 106,703,076 L677P probably benign Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp395 T C 14: 65,393,074 S358P probably benign Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Fbxl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fbxl5 APN 5 43765336 missense probably damaging 1.00
IGL00797:Fbxl5 APN 5 43758401 missense probably damaging 1.00
IGL00811:Fbxl5 APN 5 43758225 missense probably damaging 1.00
IGL01065:Fbxl5 APN 5 43745334 missense probably damaging 1.00
IGL01626:Fbxl5 APN 5 43758705 missense probably benign 0.00
IGL02285:Fbxl5 APN 5 43765348 missense possibly damaging 0.88
D3080:Fbxl5 UTSW 5 43758366 missense probably benign 0.00
PIT4498001:Fbxl5 UTSW 5 43750981 missense possibly damaging 0.73
R0195:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R0647:Fbxl5 UTSW 5 43768069 missense probably damaging 0.98
R1545:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R1569:Fbxl5 UTSW 5 43765461 missense probably damaging 1.00
R1921:Fbxl5 UTSW 5 43765490 missense probably benign 0.16
R3081:Fbxl5 UTSW 5 43750880 missense probably damaging 1.00
R3776:Fbxl5 UTSW 5 43758276 missense possibly damaging 0.57
R4096:Fbxl5 UTSW 5 43758241 missense probably benign 0.19
R4275:Fbxl5 UTSW 5 43762772 intron probably benign
R4383:Fbxl5 UTSW 5 43762963 intron probably benign
R4469:Fbxl5 UTSW 5 43768186 missense probably damaging 1.00
R4654:Fbxl5 UTSW 5 43765429 missense probably damaging 0.99
R5067:Fbxl5 UTSW 5 43758772 missense probably benign 0.00
R5093:Fbxl5 UTSW 5 43773554 missense probably damaging 1.00
R5696:Fbxl5 UTSW 5 43758840 missense possibly damaging 0.93
R5738:Fbxl5 UTSW 5 43762828 missense probably benign 0.30
R6029:Fbxl5 UTSW 5 43765404 missense probably damaging 0.96
R6185:Fbxl5 UTSW 5 43821552 missense probably benign 0.02
R6842:Fbxl5 UTSW 5 43773586 missense probably damaging 1.00
R7234:Fbxl5 UTSW 5 43758220 missense probably benign 0.08
R7563:Fbxl5 UTSW 5 43821549 missense probably benign 0.00
R7653:Fbxl5 UTSW 5 43758774 missense probably benign
R7842:Fbxl5 UTSW 5 43758603 missense probably damaging 1.00
R7860:Fbxl5 UTSW 5 43758676 missense probably benign 0.00
R8139:Fbxl5 UTSW 5 43758745 nonsense probably null
R8393:Fbxl5 UTSW 5 43768091 missense possibly damaging 0.94
RF012:Fbxl5 UTSW 5 43773505 missense probably damaging 1.00
X0065:Fbxl5 UTSW 5 43760798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTGCAGAAGTCGCTGGG -3'
(R):5'- CTTTCTGAAAAGTGCAGGCAAGGC -3'

Sequencing Primer
(F):5'- GCTGTCCCTGTACAACAGAATG -3'
(R):5'- AGGCAAGGCTGCTTCAAC -3'
Posted On2014-04-13