Mutagenetix > Incidental Mutation

Incidental Mutation 'R1540:Atp6v0a2'

171653

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

039579-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R1540 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 124646698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 307 (A307D)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: A307D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: A307D

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Meta Mutation Damage Score

0.9005

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	G	3: 116,780,735	C767R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Ap3d1	A	T	10: 80,715,941	I644N	probably benign	Het
Asb16	A	G	11: 102,272,576	I131V	probably benign	Het
C1qtnf1	C	T	11: 118,447,923	H140Y	probably benign	Het
Cacna1g	T	A	11: 94,457,039	D741V	probably damaging	Het
Caprin2	T	A	6: 148,876,471	T211S	probably benign	Het
Carmil1	T	C	13: 24,099,054	E89G	possibly damaging	Het
Casz1	T	A	4: 148,942,900		probably benign	Het
Catsperb	G	A	12: 101,412,330	R30Q	probably benign	Het
Ccdc102a	A	T	8: 94,907,713		probably null	Het
Ccdc110	G	T	8: 45,942,325	E418*	probably null	Het
Ccdc90b	C	T	7: 92,581,816	A210V	probably benign	Het
Cdadc1	G	T	14: 59,586,083	A320E	probably damaging	Het
Cdadc1	T	A	14: 59,586,092	Q317L	probably damaging	Het
Cep170	C	A	1: 176,739,932	W1396L	probably damaging	Het
Col4a6	T	C	X: 141,227,858	T129A	probably damaging	Het
Ctcfl	C	T	2: 173,112,348	D319N	probably benign	Het
Dclk1	T	C	3: 55,477,823	S45P	probably damaging	Het
Efcab3	T	C	11: 105,108,900	I5581T	probably benign	Het
Evi2	T	C	11: 79,515,586	I388V	probably benign	Het
Fbxl5	A	T	5: 43,758,636	V435E	possibly damaging	Het
Fig4	A	T	10: 41,188,586	M887K	possibly damaging	Het
Glt8d1	G	A	14: 31,011,592	V345I	probably benign	Het
Gm5709	T	C	3: 59,618,652		noncoding transcript	Het
Hsp90b1	A	G	10: 86,694,042	F264L	probably damaging	Het
Id3	A	G	4: 136,143,939	S21G	possibly damaging	Het
Ighe	T	A	12: 113,271,446	N365Y	unknown	Het
Il17rd	T	G	14: 27,099,958	M403R	probably damaging	Het
Ints10	A	G	8: 68,796,713		probably benign	Het
Kcnc4	T	A	3: 107,445,427		probably null	Het
Kctd19	A	G	8: 105,387,879	S517P	probably damaging	Het
Lama5	A	G	2: 180,180,151	F2964L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,990	K405R	probably benign	Het
Lyst	T	A	13: 13,635,101	M452K	possibly damaging	Het
Mroh7	A	G	4: 106,703,076	L677P	probably benign	Het
Mrps27	T	A	13: 99,405,050	F221I	probably benign	Het
Nhlrc1	C	T	13: 47,014,344	V146M	probably damaging	Het
Nlrp9b	T	A	7: 20,048,847	C895*	probably null	Het
Nod1	T	C	6: 54,943,975	T453A	probably benign	Het
Nodal	T	C	10: 61,422,985	V67A	probably damaging	Het
Ntsr1	T	C	2: 180,542,647	L381P	probably damaging	Het
Olfr1360	T	A	13: 21,674,530	Q138L	probably benign	Het
Olfr272	T	C	4: 52,910,996	D266G	probably benign	Het
Olfr311	T	A	11: 58,841,651	M179K	probably benign	Het
P2ry14	T	A	3: 59,115,265	K267M	probably benign	Het
Pcdh1	T	C	18: 38,189,726	N1018S	probably benign	Het
Pkn3	G	A	2: 30,084,691	V406I	probably damaging	Het
Prkcb	C	T	7: 122,627,693	T634I	probably damaging	Het
Psme2b	T	A	11: 48,945,382		probably null	Het
Ptgfrn	A	G	3: 101,060,654	I541T	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapb	T	C	2: 158,465,826	V684A	probably benign	Het
Rbbp5	C	T	1: 132,494,282	R307*	probably null	Het
Rcor1	T	A	12: 111,103,603		probably benign	Het
Rlbp1	C	T	7: 79,380,060	A142T	probably damaging	Het
Rps6ka2	A	G	17: 7,292,906	E581G	probably null	Het
Sars	A	T	3: 108,433,145	V155E	probably benign	Het
Sec31a	G	C	5: 100,375,319	P569A	probably damaging	Het
Selenof	A	T	3: 144,594,924	K111*	probably null	Het
Serpinb7	C	T	1: 107,428,268	A7V	possibly damaging	Het
Smc4	T	A	3: 69,016,772	Y298N	probably damaging	Het
Snrpa1	T	A	7: 66,070,661	I204N	probably damaging	Het
Spry4	T	G	18: 38,601,687		probably benign	Het
Tcea2	A	G	2: 181,686,958	N261S	possibly damaging	Het
Tmem59l	A	G	8: 70,485,154	F192S	probably benign	Het
Tnr	T	A	1: 159,850,105	I20N	probably damaging	Het
Ttll5	C	T	12: 85,892,208	Q427*	probably null	Het
Vps45	C	T	3: 96,048,346	A111T	probably damaging	Het
Zfp395	T	C	14: 65,393,074	S358P	probably benign	Het
Zfp438	A	G	18: 5,210,740	V766A	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAAAAGCCCTTTGTGTCTCTCTG -3'
(R):5'- ACCCTGTGGCATACTATGTCCTCG -3'

Sequencing Primer
(F):5'- TTCACACATGGAAACTTCAGGG -3'
(R):5'- TATGTCCTCGAGAGGGTCCTAATG -3'

Posted On

2014-04-13