Incidental Mutation 'R1540:Ptpro'
ID171655
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 039579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1540 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137443594 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1007 (V1007D)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V1035D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1035D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: V214D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V214D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1007D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: V186D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V186D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.9197 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Caprin2 T A 6: 148,876,471 T211S probably benign Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Casz1 T A 4: 148,942,900 probably benign Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fbxl5 A T 5: 43,758,636 V435E possibly damaging Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mroh7 A G 4: 106,703,076 L677P probably benign Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp395 T C 14: 65,393,074 S358P probably benign Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGTGATCCTCTGCCAACTTC -3'
(R):5'- CCTTTCAAAAGAATGATGCAGCCCC -3'

Sequencing Primer
(F):5'- TTCGTCATCAGCAAAAACGGC -3'
(R):5'- TGATGCAGCCCCATGAAG -3'
Posted On2014-04-13