Mutagenetix > Incidental Mutations

Incidental Mutation 'R1540:Ap3d1'

171671

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

039579-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R1540 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80715941 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 644 (I644N)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: I644N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: I644N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	G	3: 116,780,735	C767R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Asb16	A	G	11: 102,272,576	I131V	probably benign	Het
Atp6v0a2	C	A	5: 124,646,698	A307D	probably damaging	Het
C1qtnf1	C	T	11: 118,447,923	H140Y	probably benign	Het
Cacna1g	T	A	11: 94,457,039	D741V	probably damaging	Het
Caprin2	T	A	6: 148,876,471	T211S	probably benign	Het
Carmil1	T	C	13: 24,099,054	E89G	possibly damaging	Het
Casz1	T	A	4: 148,942,900		probably benign	Het
Catsperb	G	A	12: 101,412,330	R30Q	probably benign	Het
Ccdc102a	A	T	8: 94,907,713		probably null	Het
Ccdc110	G	T	8: 45,942,325	E418*	probably null	Het
Ccdc90b	C	T	7: 92,581,816	A210V	probably benign	Het
Cdadc1	G	T	14: 59,586,083	A320E	probably damaging	Het
Cdadc1	T	A	14: 59,586,092	Q317L	probably damaging	Het
Cep170	C	A	1: 176,739,932	W1396L	probably damaging	Het
Col4a6	T	C	X: 141,227,858	T129A	probably damaging	Het
Ctcfl	C	T	2: 173,112,348	D319N	probably benign	Het
Dclk1	T	C	3: 55,477,823	S45P	probably damaging	Het
Efcab3	T	C	11: 105,108,900	I5581T	probably benign	Het
Evi2	T	C	11: 79,515,586	I388V	probably benign	Het
Fbxl5	A	T	5: 43,758,636	V435E	possibly damaging	Het
Fig4	A	T	10: 41,188,586	M887K	possibly damaging	Het
Glt8d1	G	A	14: 31,011,592	V345I	probably benign	Het
Gm5709	T	C	3: 59,618,652		noncoding transcript	Het
Hsp90b1	A	G	10: 86,694,042	F264L	probably damaging	Het
Id3	A	G	4: 136,143,939	S21G	possibly damaging	Het
Ighe	T	A	12: 113,271,446	N365Y	unknown	Het
Il17rd	T	G	14: 27,099,958	M403R	probably damaging	Het
Ints10	A	G	8: 68,796,713		probably benign	Het
Kcnc4	T	A	3: 107,445,427		probably null	Het
Kctd19	A	G	8: 105,387,879	S517P	probably damaging	Het
Lama5	A	G	2: 180,180,151	F2964L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lrrc8e	A	G	8: 4,234,990	K405R	probably benign	Het
Lyst	T	A	13: 13,635,101	M452K	possibly damaging	Het
Mroh7	A	G	4: 106,703,076	L677P	probably benign	Het
Mrps27	T	A	13: 99,405,050	F221I	probably benign	Het
Nhlrc1	C	T	13: 47,014,344	V146M	probably damaging	Het
Nlrp9b	T	A	7: 20,048,847	C895*	probably null	Het
Nod1	T	C	6: 54,943,975	T453A	probably benign	Het
Nodal	T	C	10: 61,422,985	V67A	probably damaging	Het
Ntsr1	T	C	2: 180,542,647	L381P	probably damaging	Het
Olfr1360	T	A	13: 21,674,530	Q138L	probably benign	Het
Olfr272	T	C	4: 52,910,996	D266G	probably benign	Het
Olfr311	T	A	11: 58,841,651	M179K	probably benign	Het
P2ry14	T	A	3: 59,115,265	K267M	probably benign	Het
Pcdh1	T	C	18: 38,189,726	N1018S	probably benign	Het
Pkn3	G	A	2: 30,084,691	V406I	probably damaging	Het
Prkcb	C	T	7: 122,627,693	T634I	probably damaging	Het
Psme2b	T	A	11: 48,945,382		probably null	Het
Ptgfrn	A	G	3: 101,060,654	I541T	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapb	T	C	2: 158,465,826	V684A	probably benign	Het
Rbbp5	C	T	1: 132,494,282	R307*	probably null	Het
Rcor1	T	A	12: 111,103,603		probably benign	Het
Rlbp1	C	T	7: 79,380,060	A142T	probably damaging	Het
Rps6ka2	A	G	17: 7,292,906	E581G	probably null	Het
Sars	A	T	3: 108,433,145	V155E	probably benign	Het
Sec31a	G	C	5: 100,375,319	P569A	probably damaging	Het
Selenof	A	T	3: 144,594,924	K111*	probably null	Het
Serpinb7	C	T	1: 107,428,268	A7V	possibly damaging	Het
Smc4	T	A	3: 69,016,772	Y298N	probably damaging	Het
Snrpa1	T	A	7: 66,070,661	I204N	probably damaging	Het
Spry4	T	G	18: 38,601,687		probably benign	Het
Tcea2	A	G	2: 181,686,958	N261S	possibly damaging	Het
Tmem59l	A	G	8: 70,485,154	F192S	probably benign	Het
Tnr	T	A	1: 159,850,105	I20N	probably damaging	Het
Ttll5	C	T	12: 85,892,208	Q427*	probably null	Het
Vps45	C	T	3: 96,048,346	A111T	probably damaging	Het
Zfp395	T	C	14: 65,393,074	S358P	probably benign	Het
Zfp438	A	G	18: 5,210,740	V766A	probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AAGGTCATCTGGCCTCTGTGTCAC -3'
(R):5'- TAAAGTCACTCCATCCAGGGACCG -3'

Sequencing Primer
(F):5'- TATGTGTGGCAGCACAGC -3'
(R):5'- TCCAGGAGTCCCCTTGTCAG -3'

Posted On

2014-04-13