Incidental Mutation 'R1540:Zfp395'
ID171693
Institutional Source Beutler Lab
Gene Symbol Zfp395
Ensembl Gene ENSMUSG00000034522
Gene Namezinc finger protein 395
SynonymsLOC380912, BC027382
MMRRC Submission 039579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1540 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65358389-65398930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65393074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000064422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066994]
Predicted Effect probably benign
Transcript: ENSMUST00000066994
AA Change: S358P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064422
Gene: ENSMUSG00000034522
AA Change: S358P

DomainStartEndE-ValueType
Pfam:DUF4772 2 110 5.3e-31 PFAM
low complexity region 162 174 N/A INTRINSIC
low complexity region 208 234 N/A INTRINSIC
ZnF_C2H2 279 304 1.25e-1 SMART
low complexity region 356 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
c-clamp 478 508 1.88e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225512
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Caprin2 T A 6: 148,876,471 T211S probably benign Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Casz1 T A 4: 148,942,900 probably benign Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fbxl5 A T 5: 43,758,636 V435E possibly damaging Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mroh7 A G 4: 106,703,076 L677P probably benign Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Zfp395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp395 APN 14 65394751 splice site probably null
IGL01712:Zfp395 APN 14 65386387 missense probably damaging 0.98
IGL02885:Zfp395 APN 14 65395895 missense probably benign 0.05
R0243:Zfp395 UTSW 14 65386480 missense probably benign
R2005:Zfp395 UTSW 14 65388885 missense possibly damaging 0.87
R2108:Zfp395 UTSW 14 65393116 missense probably benign 0.24
R3499:Zfp395 UTSW 14 65391293 missense possibly damaging 0.87
R4790:Zfp395 UTSW 14 65386541 missense possibly damaging 0.74
R4790:Zfp395 UTSW 14 65393207 missense probably damaging 1.00
R6978:Zfp395 UTSW 14 65386433 missense probably benign 0.05
RF024:Zfp395 UTSW 14 65385425 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCACACAGGGACACTGTTGACTC -3'
(R):5'- AGTGACAGCTCTCAGATCACAGCC -3'

Sequencing Primer
(F):5'- AAAGAGGAATCTGCTCAGGC -3'
(R):5'- acttttattcctcctatctccacc -3'
Posted On2014-04-13