Incidental Mutation 'R1541:Tfap2b'
ID171699
Institutional Source Beutler Lab
Gene Symbol Tfap2b
Ensembl Gene ENSMUSG00000025927
Gene Nametranscription factor AP-2 beta
SynonymsAP-2(beta), Tcfap2b, E130018K07Rik
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location19208914-19238576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19234070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 350 (T350M)
Ref Sequence ENSEMBL: ENSMUSP00000064488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027059] [ENSMUST00000064976] [ENSMUST00000187754]
Predicted Effect probably benign
Transcript: ENSMUST00000027059
AA Change: T368M

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027059
Gene: ENSMUSG00000025927
AA Change: T368M

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 228 428 7.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064976
AA Change: T350M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064488
Gene: ENSMUSG00000025927
AA Change: T350M

DomainStartEndE-ValueType
low complexity region 43 65 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 178 192 N/A INTRINSIC
Pfam:TF_AP-2 208 415 2.2e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187754
AA Change: T368M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140213
Gene: ENSMUSG00000025927
AA Change: T368M

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 226 433 2.2e-101 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have kidney cysts and show neonatal or postnatal lethality, depending on strain background. On a congenic 129P2 background, mice have tremors, polydactyly, defective tubular secretory function and ion homeostasis, hypocalcemia, hyperphosphatemia, hyperuremia, and terminal renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Tfap2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tfap2b APN 1 19214026 missense possibly damaging 0.94
IGL01868:Tfap2b APN 1 19214282 missense probably damaging 0.98
IGL02408:Tfap2b APN 1 19234261 missense probably damaging 0.99
IGL02412:Tfap2b APN 1 19219203 missense probably damaging 0.99
R0243:Tfap2b UTSW 1 19234123 missense probably damaging 1.00
R0552:Tfap2b UTSW 1 19234225 missense probably damaging 1.00
R1077:Tfap2b UTSW 1 19234149 nonsense probably null
R1816:Tfap2b UTSW 1 19209212 missense probably damaging 0.98
R2474:Tfap2b UTSW 1 19214375 missense possibly damaging 0.49
R5019:Tfap2b UTSW 1 19226442 missense probably benign 0.31
R5300:Tfap2b UTSW 1 19228453 missense probably damaging 1.00
R5331:Tfap2b UTSW 1 19226498 missense probably benign
R5383:Tfap2b UTSW 1 19226498 missense probably benign
R5541:Tfap2b UTSW 1 19214026 missense possibly damaging 0.94
R5744:Tfap2b UTSW 1 19219221 missense probably benign 0.15
R7239:Tfap2b UTSW 1 19234180 missense probably damaging 1.00
R7684:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7686:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7775:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7778:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7824:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R8305:Tfap2b UTSW 1 19226436 missense possibly damaging 0.80
X0026:Tfap2b UTSW 1 19226550 missense probably damaging 1.00
Z1176:Tfap2b UTSW 1 19234133 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTAAAGCAGAATACAGGTGGTCCCG -3'
(R):5'- ACATCTTGTCCATGCCTTTGAGCG -3'

Sequencing Primer
(F):5'- AGGTGGTCCCGGAACAG -3'
(R):5'- CGCCTCGGTGAGATAGTTC -3'
Posted On2014-04-13