Incidental Mutation 'R1541:Angptl2'
ID 171703
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Name angiopoietin-like 2
Synonyms Arp2
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock # R1541 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 33216069-33247717 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33246165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 454 (R454H)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
AlphaFold Q9R045
Predicted Effect probably benign
Transcript: ENSMUST00000004208
AA Change: R454H

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: R454H

signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Znfx1 A T 2: 167,056,190 N271K probably damaging Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
Grazie UTSW 2 33243910 nonsense probably null
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
R8719:Angptl2 UTSW 2 33243902 missense possibly damaging 0.74
R8927:Angptl2 UTSW 2 33242304 missense probably benign 0.35
R8928:Angptl2 UTSW 2 33242304 missense probably benign 0.35
R9204:Angptl2 UTSW 2 33228330 missense probably benign
R9663:Angptl2 UTSW 2 33228219 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gctgcctatctgtaatctaccatc -3'
Posted On 2014-04-13